ID: 1196841667

View in Genome Browser
Species Human (GRCh38)
Location X:119864966-119864988
Sequence AACACTGAAGAAGCCCCTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196841667_1196841669 3 Left 1196841667 X:119864966-119864988 CCTTGAGGGGCTTCTTCAGTGTT No data
Right 1196841669 X:119864992-119865014 AGTCTTGTAGTTCTTGACCCGGG No data
1196841667_1196841668 2 Left 1196841667 X:119864966-119864988 CCTTGAGGGGCTTCTTCAGTGTT No data
Right 1196841668 X:119864991-119865013 CAGTCTTGTAGTTCTTGACCCGG No data
1196841667_1196841671 9 Left 1196841667 X:119864966-119864988 CCTTGAGGGGCTTCTTCAGTGTT No data
Right 1196841671 X:119864998-119865020 GTAGTTCTTGACCCGGGTGGTGG No data
1196841667_1196841672 18 Left 1196841667 X:119864966-119864988 CCTTGAGGGGCTTCTTCAGTGTT No data
Right 1196841672 X:119865007-119865029 GACCCGGGTGGTGGTTATGCAGG No data
1196841667_1196841670 6 Left 1196841667 X:119864966-119864988 CCTTGAGGGGCTTCTTCAGTGTT No data
Right 1196841670 X:119864995-119865017 CTTGTAGTTCTTGACCCGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196841667 Original CRISPR AACACTGAAGAAGCCCCTCA AGG (reversed) Intergenic
No off target data available for this crispr