ID: 1196841672

View in Genome Browser
Species Human (GRCh38)
Location X:119865007-119865029
Sequence GACCCGGGTGGTGGTTATGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196841667_1196841672 18 Left 1196841667 X:119864966-119864988 CCTTGAGGGGCTTCTTCAGTGTT No data
Right 1196841672 X:119865007-119865029 GACCCGGGTGGTGGTTATGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196841672 Original CRISPR GACCCGGGTGGTGGTTATGC AGG Intergenic
No off target data available for this crispr