ID: 1196844653

View in Genome Browser
Species Human (GRCh38)
Location X:119888538-119888560
Sequence GGGGGTAAGAAGTAAAGTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196844644_1196844653 11 Left 1196844644 X:119888504-119888526 CCAAAATTTGTGCGTTTCAGTAA No data
Right 1196844653 X:119888538-119888560 GGGGGTAAGAAGTAAAGTTCTGG No data
1196844642_1196844653 20 Left 1196844642 X:119888495-119888517 CCCTGGAAGCCAAAATTTGTGCG No data
Right 1196844653 X:119888538-119888560 GGGGGTAAGAAGTAAAGTTCTGG No data
1196844643_1196844653 19 Left 1196844643 X:119888496-119888518 CCTGGAAGCCAAAATTTGTGCGT No data
Right 1196844653 X:119888538-119888560 GGGGGTAAGAAGTAAAGTTCTGG No data
1196844641_1196844653 29 Left 1196844641 X:119888486-119888508 CCTAGAGAGCCCTGGAAGCCAAA No data
Right 1196844653 X:119888538-119888560 GGGGGTAAGAAGTAAAGTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196844653 Original CRISPR GGGGGTAAGAAGTAAAGTTC TGG Intergenic
No off target data available for this crispr