ID: 1196849940

View in Genome Browser
Species Human (GRCh38)
Location X:119927717-119927739
Sequence AGATTTCCCCTACAAATAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 101
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 95}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196849940_1196849943 2 Left 1196849940 X:119927717-119927739 CCTCCTATTTGTAGGGGAAATCT 0: 1
1: 0
2: 0
3: 5
4: 95
Right 1196849943 X:119927742-119927764 CCTTCCTGCTCTTCTTTTTCAGG 0: 1
1: 0
2: 10
3: 56
4: 611
1196849940_1196849945 12 Left 1196849940 X:119927717-119927739 CCTCCTATTTGTAGGGGAAATCT 0: 1
1: 0
2: 0
3: 5
4: 95
Right 1196849945 X:119927752-119927774 CTTCTTTTTCAGGAGTGACTTGG 0: 1
1: 0
2: 5
3: 53
4: 596

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196849940 Original CRISPR AGATTTCCCCTACAAATAGG AGG (reversed) Intronic
900535420 1:3174680-3174702 AAATTTCCCCAGCAAAGAGGTGG - Intronic
907017739 1:51033640-51033662 AGATTTCTCCTACAAAGTGTAGG + Intergenic
908055185 1:60278275-60278297 ACTTATCCCCTGCAAATAGGAGG + Intergenic
911273091 1:95827309-95827331 AAATTTTCCCTTCACATAGGTGG - Intergenic
912534491 1:110355457-110355479 AGATTTCTCCTAGAAATGAGAGG + Intergenic
915087926 1:153400629-153400651 AGATTTCCCCAGCAAACAAGTGG + Intergenic
915722047 1:157993067-157993089 AGATTGCGTCTATAAATAGGAGG + Intergenic
918149319 1:181784545-181784567 AGATTTCCTCTTAAAATATGAGG + Intronic
1065112303 10:22452273-22452295 AGATTTACCCTTCAACTTGGTGG - Intronic
1066617478 10:37310123-37310145 CAATTTCTCCTGCAAATAGGTGG + Intronic
1070267474 10:74917981-74918003 AAACTTACCCTACAAATATGAGG - Intronic
1073822004 10:107274768-107274790 AGATTTCTACAACTAATAGGAGG + Intergenic
1079595272 11:22237052-22237074 GGATTTCCACTGCCAATAGGTGG - Intronic
1083065736 11:59922203-59922225 AGAATTTCTATACAAATAGGTGG - Intergenic
1085378589 11:76091237-76091259 ATATTTCACATACAAAAAGGGGG - Intronic
1090856873 11:130617495-130617517 ACATATCCCCTACAGATAAGGGG + Intergenic
1091245105 11:134086525-134086547 AAATTTCCCCTAGGCATAGGAGG - Intronic
1091437056 12:481169-481191 AGACTTCCCCTCCAAAGAAGAGG + Intronic
1095600822 12:44011216-44011238 ATGTATCCCCTACAGATAGGAGG - Intronic
1098063554 12:66587885-66587907 AGATTTCCCCTTCAAAATGTGGG - Intronic
1104825837 12:131709096-131709118 AGTTCTCCCCTAGAAATAGAAGG - Intergenic
1105629010 13:22142684-22142706 AGCTGTCCCCGACACATAGGAGG - Intergenic
1105660128 13:22484927-22484949 GGATTTTGCCTTCAAATAGGTGG + Intergenic
1110293582 13:73836106-73836128 GCATTTCCCCTACATAAAGGTGG + Intronic
1110815998 13:79860551-79860573 AGTTTTCCCCAACAGATTGGAGG + Intergenic
1112384228 13:98922868-98922890 AGCTTTCCTCTAGGAATAGGGGG + Intronic
1112684951 13:101814048-101814070 TGATTTCCCCTCTAAATAAGTGG - Intronic
1112752854 13:102599212-102599234 ATATTTACCCTCCAAATAGTTGG - Intronic
1116914965 14:50515838-50515860 AGATGTGCCCTAGAAATAGATGG - Intronic
1120813932 14:88833597-88833619 AGAGTTCACCTACAAATACTTGG + Intronic
1123170801 14:106371128-106371150 GGATTTCCCCTGGAAATAGTGGG - Intergenic
1129023984 15:72551731-72551753 AGATTTCCCCTACTTATAAATGG + Intronic
1133069053 16:3233800-3233822 AGATTTCCTCTAGTAAGAGGTGG - Exonic
1133416140 16:5608470-5608492 AGGCTTCCACAACAAATAGGTGG - Intergenic
1135176868 16:20237799-20237821 AGATTTTCCATCCAAATACGGGG + Intergenic
1138254330 16:55540729-55540751 ACATATCCCCTACAGATAAGGGG - Intronic
1140238476 16:73180243-73180265 AAATTTTCCCTACAAATATTTGG - Intergenic
1140852008 16:78943771-78943793 AGATTTCCCCTTCAAATTGTGGG - Intronic
1143207845 17:5158108-5158130 AGATGTCATCAACAAATAGGTGG + Intronic
1147791732 17:43018028-43018050 AGATTTCCCCTAAAGGTGGGGGG - Exonic
1148074406 17:44927200-44927222 AGGTTTCTTCTACAAAGAGGTGG + Intronic
1149324754 17:55518564-55518586 AGAAAACCCCTAAAAATAGGTGG + Intergenic
1149403166 17:56319728-56319750 AAATTTCACCTATCAATAGGTGG - Intronic
1152456830 17:80421636-80421658 AGATGTACCCTGCAAATTGGTGG - Intronic
1153822490 18:8844219-8844241 AAATTTCCCCTGCAAAGACGAGG + Intergenic
1155231127 18:23776218-23776240 ATATTTCTCCTACATTTAGGAGG - Intronic
1167806694 19:51791604-51791626 GGATTTCCCATACAAATCTGGGG + Intronic
928443470 2:31312655-31312677 AGCTTTCCCCTATAACCAGGAGG + Intergenic
931017711 2:58004711-58004733 AGATTTCCCTTTCATATATGTGG + Intronic
931757281 2:65385352-65385374 AGATTTCCCCTTTACATAAGAGG + Intronic
932668552 2:73717708-73717730 AGATTTCCCCAAGAAATGTGTGG - Intergenic
938004347 2:127775602-127775624 ATATTTACTCTACAAATATGAGG + Intronic
947991190 2:234488935-234488957 AGAATTCCCCTACACGCAGGAGG + Intergenic
948497284 2:238359747-238359769 ACATATCCCCTGCAAATAAGAGG - Intronic
1169513754 20:6294465-6294487 AGATTACCTCTACAAATACTTGG + Intergenic
1173427547 20:42956052-42956074 AGCTTTCCCCCACACACAGGTGG + Intronic
952072202 3:29650837-29650859 AGATTTTCCATACAAATAGATGG - Intronic
957770269 3:84682263-84682285 ATTTTTCACCTACAAATTGGAGG + Intergenic
964077467 3:152708835-152708857 AGATTTACCCTACAAAAATGTGG - Intergenic
964843269 3:161017769-161017791 AGGTTTCCACTACAAATACAAGG + Intronic
973539787 4:51924477-51924499 ATATTTCCCCTGGAAATATGGGG - Intergenic
975716341 4:77209021-77209043 AGAGTTCCCCTAGAACTTGGAGG + Intronic
976911528 4:90313146-90313168 AAATTTTCCCTTCAAATATGAGG - Intronic
982971334 4:161991849-161991871 AGATTTCCATTTTAAATAGGTGG + Intronic
985377214 4:189354459-189354481 AAATATCCCCTACACAGAGGAGG - Intergenic
986265005 5:6183701-6183723 AGATTTACCGTACGAAAAGGTGG - Intergenic
986815131 5:11400988-11401010 AGATTTCTCCTGCAAACAAGTGG - Intronic
987164588 5:15182556-15182578 AAATATCCCCTACTAAAAGGAGG + Intergenic
988899180 5:35713352-35713374 AGAGTTCCACTAAAAATAGATGG - Intronic
990324318 5:54660056-54660078 AGATTTCCCAGAAAAATAAGTGG + Intergenic
993601940 5:89936965-89936987 ATTTTTCCCCTACAAAGAGATGG - Intergenic
994676785 5:102833214-102833236 AAATTTCCCCAACCAATAGAAGG - Intronic
1003137667 6:3445800-3445822 AGATGCCCCCTACAACAAGGAGG + Intronic
1006498031 6:34438052-34438074 AAATTTCCCCCACAAAAAGATGG - Intergenic
1006895949 6:37471103-37471125 AGATCTTCCCTTGAAATAGGTGG - Intronic
1007136405 6:39525894-39525916 TGATTCCCCCTACAACTAGATGG + Intronic
1010663186 6:78595644-78595666 ACATTTCTCCTACTAATGGGTGG + Intergenic
1010763597 6:79752741-79752763 AGAATTTCCCTACAAATAGTAGG + Intergenic
1018588637 6:165390813-165390835 AGATTTCCCTTCCAATTATGTGG - Intronic
1018786375 6:167111236-167111258 AGATTTCCCCTTAAATTACGAGG + Intergenic
1021496306 7:21278275-21278297 AGATTTCCTGAAGAAATAGGTGG + Intergenic
1027965389 7:84999201-84999223 AGAATTATCCTAAAAATAGGGGG - Exonic
1030886449 7:114944353-114944375 AGATTTCACCCACAAATATTTGG - Intronic
1032501465 7:132403376-132403398 AGATTTCCCCTACTCAGGGGAGG + Intronic
1038364731 8:26919522-26919544 AGATTTCCGCAAGAAATAAGTGG - Intergenic
1040514044 8:48120135-48120157 AGGTTTCACCTTCTAATAGGAGG + Intergenic
1045064603 8:98434448-98434470 AAATTTCTCCTAAAAGTAGGAGG - Intronic
1046792617 8:118338008-118338030 AGGTATCCCCTACAGATAAGGGG + Intronic
1050019594 9:1269432-1269454 AGATACCCCCTACAAAAAAGTGG + Intergenic
1050286115 9:4104108-4104130 AGATGTTACCTAGAAATAGGTGG + Intronic
1050435118 9:5600718-5600740 AGAATTCCCCTAGAATTAGATGG - Intergenic
1051506819 9:17836549-17836571 GGATTTCCCCTAGTAATAGAAGG + Intergenic
1059074514 9:111178277-111178299 AGTTTTGCCCTACATATAAGAGG - Intergenic
1188793309 X:34432039-34432061 AAATTTCCCTTAGAAAAAGGAGG - Intergenic
1189737189 X:44083569-44083591 ACATATCCCCTGCAAATAAGGGG + Intergenic
1193545588 X:82823719-82823741 AGATTATAACTACAAATAGGTGG - Intergenic
1196041015 X:111203982-111204004 AGGTTTGCCCTCAAAATAGGAGG - Intronic
1196849940 X:119927717-119927739 AGATTTCCCCTACAAATAGGAGG - Intronic
1197309526 X:124887288-124887310 AGATTTGTACTACAAATATGGGG + Intronic
1198176896 X:134165634-134165656 AGATTTCTCCTACAAATACATGG - Intergenic
1201378939 Y:13351448-13351470 ATATATCCCCTACGAATATGAGG - Intronic