ID: 1196850123

View in Genome Browser
Species Human (GRCh38)
Location X:119929672-119929694
Sequence CCTAACTGCCACATTCCTCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 298
Summary {0: 1, 1: 0, 2: 4, 3: 31, 4: 262}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196850121_1196850123 7 Left 1196850121 X:119929642-119929664 CCAGGAAACACTGTCTTGTGAAA 0: 1
1: 0
2: 1
3: 18
4: 222
Right 1196850123 X:119929672-119929694 CCTAACTGCCACATTCCTCATGG 0: 1
1: 0
2: 4
3: 31
4: 262

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196850123 Original CRISPR CCTAACTGCCACATTCCTCA TGG Intronic
900513891 1:3072408-3072430 CCTAGATGCCACATACCCCAGGG + Intronic
902228000 1:15008842-15008864 CCTGCCAGCCACAGTCCTCAAGG + Intronic
903011687 1:20335472-20335494 CCTAACCTCCACATTGTTCAAGG - Intronic
903468441 1:23568382-23568404 CCGAACAGCCACATTCCTTCGGG - Intergenic
903964899 1:27081668-27081690 CCTAACTGGCACATGTATCATGG + Intergenic
905084404 1:35358010-35358032 CCTAAATGGCATATCCCTCATGG - Intronic
908048242 1:60196296-60196318 CCTAACTCCCACATTGTTCAAGG - Intergenic
909142536 1:71886924-71886946 GCTAACTCCCACATTGCTCAAGG - Intronic
909487326 1:76188560-76188582 CCTAACTCCCATATTGTTCAAGG - Intronic
909681444 1:78295798-78295820 CCTAACTTCTGCATTCTTCAAGG + Intergenic
911174660 1:94806924-94806946 CCTATCTCCCGCATGCCTCAAGG + Intergenic
911179335 1:94847351-94847373 CCTCCCTGCCACCCTCCTCAAGG - Intronic
911930516 1:103897001-103897023 CCTAACTTCCACATTGTTCAAGG + Intergenic
913220122 1:116653382-116653404 CATAAATACCACAGTCCTCAAGG + Intronic
915887554 1:159739251-159739273 CCTAACTCCCACGTTGTTCAAGG + Intergenic
917013462 1:170502092-170502114 CCTTCCTGCAACATGCCTCATGG - Intergenic
917064587 1:171077704-171077726 CCTTCCTGGCACATTCTTCAAGG + Intergenic
917091671 1:171359467-171359489 CCAAAGTGCACCATTCCTCACGG - Intergenic
918460225 1:184768698-184768720 TCTTACTTGCACATTCCTCAGGG + Intergenic
918587731 1:186207113-186207135 CTTGGCTGCCACATTCCCCAGGG - Intergenic
918661502 1:187094073-187094095 CCTAACTCCCACATTACCCAAGG - Intergenic
919021186 1:192108109-192108131 TCTAAGTGCCACCTGCCTCATGG - Intergenic
919802960 1:201364573-201364595 CCCACCTCCAACATTCCTCATGG + Intronic
920192377 1:204201853-204201875 CCTAAGTCCCTCACTCCTCAGGG - Intronic
921080346 1:211733968-211733990 CCTAACTCCCTCATTGTTCAAGG - Intergenic
922482104 1:225946238-225946260 CCTAAGTGCCTCAGTCCTAACGG - Intergenic
923431548 1:233926084-233926106 CCTAACTGTCAGATTCACCAAGG - Intronic
923993565 1:239466551-239466573 CCTAACTCCCACATTATTTAAGG + Intronic
924389661 1:243539505-243539527 CGTAACTCCCACATTGTTCAAGG + Intronic
1063501510 10:6559274-6559296 CTTATCTGCCCCAGTCCTCAAGG - Intronic
1064729131 10:18311391-18311413 CCTAACCGCCACATTGCTCAAGG - Intronic
1066129713 10:32380990-32381012 CCTAACCCCCACATACTTCAAGG - Intergenic
1066296596 10:34059376-34059398 CCTAACAGACAGATTTCTCAAGG - Intergenic
1067451313 10:46383804-46383826 CCCTACTACCACAGTCCTCAAGG - Intronic
1067585929 10:47475952-47475974 CCCTACTACCACAGTCCTCAAGG + Intronic
1069358003 10:67609838-67609860 GCTAACTGCCACATTTAGCATGG - Intronic
1069863734 10:71487290-71487312 CCTAACCCCCACATTGCTCAAGG - Intronic
1071010566 10:80935660-80935682 CCTAACCTCCACATTGTTCAAGG + Intergenic
1072050630 10:91699792-91699814 CCTGGCTGCCAGAGTCCTCAAGG + Intergenic
1072371108 10:94767256-94767278 CCTGAAGGCCACAATCCTCAGGG - Intronic
1073483294 10:103800424-103800446 GCTGACAGCCATATTCCTCAGGG + Intronic
1074001186 10:109374896-109374918 CCTAACACCCACATTGTTCAAGG + Intergenic
1074315821 10:112360708-112360730 CCTAACGGGGACATTCCTAAAGG + Intergenic
1075031138 10:119025504-119025526 CCAAGCTGCCTCATTCCCCAGGG + Intergenic
1075355173 10:121765661-121765683 CCAAACTGCCACATTCATGTGGG + Intronic
1076230896 10:128819254-128819276 CATGTCTGCCACATTCCCCAAGG + Intergenic
1076501174 10:130937429-130937451 GCTAACTGCCAAGTTCCTAAAGG + Intergenic
1078378682 11:10819481-10819503 CCTAACCTCCACATTGTTCAAGG + Intronic
1079000068 11:16745290-16745312 CCTAACCCCCACATTGCTCAAGG - Intronic
1079807149 11:24946994-24947016 CCTAACTTCCACATTGTTCAAGG - Intronic
1081768405 11:45629271-45629293 CATAATTGTCAGATTCCTCAAGG + Intergenic
1081870243 11:46380010-46380032 CCTCACTGCCACATTCCAGTGGG + Exonic
1082814026 11:57496587-57496609 CCTTCCTGGCACATTCCCCAGGG + Intronic
1084303309 11:68265211-68265233 CTAAACTGCCACATGGCTCATGG - Intronic
1086263317 11:84967494-84967516 TCTATCTGCCACATTTCTCTTGG - Intronic
1086587325 11:88469449-88469471 CCTAACCCCCACATTGTTCAAGG - Intergenic
1088543994 11:110941615-110941637 CCTAACCCCCACATTGTTCAAGG - Intergenic
1090480115 11:127060617-127060639 CCTAACTCCCATATTGTTCAAGG + Intergenic
1091666876 12:2425070-2425092 CCTGGCTGTCACATTCCCCAGGG + Intronic
1092981842 12:13803303-13803325 CCTAACCCCCACATTGTTCAAGG + Intronic
1094675524 12:32616316-32616338 ACTGACTGCCACTTTCCCCAAGG - Intronic
1095187400 12:39216689-39216711 CCTAACCCCCACACTGCTCAAGG + Intergenic
1095668518 12:44831751-44831773 CCACACTGCCATTTTCCTCATGG - Intronic
1098102970 12:67038307-67038329 TCCCACTGCCACATTCCACAAGG + Intergenic
1099256163 12:80315584-80315606 TCTAACTGACACATCCATCATGG - Intronic
1099999416 12:89815059-89815081 CCTAACCCCCACATTTTTCAAGG + Intergenic
1100821589 12:98436793-98436815 CCTAACTCCCACATTGTTCAAGG + Intergenic
1102060998 12:109930950-109930972 CCTAAGTGCCACATTGCTGTTGG - Exonic
1102430682 12:112880639-112880661 CTTAACTCCCACATTGTTCAAGG - Intronic
1102969234 12:117153166-117153188 CCTAACTGGCACCTGCCTCCCGG - Intronic
1103160360 12:118724207-118724229 CCTAACTTCCTCATTGTTCAAGG + Intergenic
1106391224 13:29337342-29337364 CCCAAATGCACCATTCCTCATGG + Intronic
1107250670 13:38357556-38357578 CCTAACTCCCACGTTATTCAAGG - Intronic
1107787658 13:43971262-43971284 CCTCACTGCCACATTCCAGTGGG + Intergenic
1108705628 13:52983130-52983152 CCTAACTCCCATATTATTCAAGG + Intergenic
1112151857 13:96773109-96773131 CCTGAATGCACCATTCCTCATGG - Intronic
1113141794 13:107160774-107160796 CCTAACTCCCAGATTTTTCAAGG - Intergenic
1113426968 13:110216193-110216215 CCTCACTGTCACAGGCCTCAGGG - Intronic
1114870172 14:26645990-26646012 CCAAAGTGCACCATTCCTCATGG + Intergenic
1117549668 14:56821663-56821685 TCTAAATGTCCCATTCCTCATGG - Intergenic
1118590167 14:67395194-67395216 CCTACCTGCCCCATTCCTATGGG - Intronic
1120788536 14:88558489-88558511 CCTCACTGTCCCCTTCCTCAGGG - Intergenic
1120907950 14:89636780-89636802 CCTAACCTCCGCATTCTTCAAGG + Intronic
1122182522 14:99966687-99966709 CCTGGCTGCCACAGTCCCCACGG + Intergenic
1122505092 14:102227061-102227083 CCTGACTGTCACACTCCTCGTGG - Intronic
1123160799 14:106276486-106276508 CACAGCTGCCTCATTCCTCAGGG + Intergenic
1124403512 15:29372524-29372546 CCTAACTGCCATGTTGTTCAAGG + Intronic
1125424350 15:39534250-39534272 CCTCTCAGCAACATTCCTCAGGG + Intergenic
1125722168 15:41850544-41850566 CCTTCCTGCCAGAATCCTCATGG - Intronic
1126694604 15:51315295-51315317 CCCAACTGCCAGACCCCTCATGG + Intronic
1126718819 15:51553958-51553980 CCTAACTGCCATGTTGTTCAAGG + Intronic
1127073827 15:55307458-55307480 CCTAGAGGCCACAATCCTCAGGG - Intronic
1127162863 15:56208439-56208461 CCTTACTACCACATTACTAAAGG + Intronic
1127707309 15:61560015-61560037 CCTAACCCCCACATTGTTCACGG - Intergenic
1131661797 15:94525059-94525081 ACTAACTCCCTCCTTCCTCAGGG - Intergenic
1134056138 16:11170967-11170989 CCCAAAGGCCACCTTCCTCACGG - Intronic
1135136513 16:19888907-19888929 CCTGAGTGCCACATTCCTTTAGG - Intergenic
1137060687 16:35789792-35789814 CCTGACTGCCATGTTCCTCTTGG - Intergenic
1137072331 16:35914395-35914417 CCTGACTTCCATGTTCCTCATGG - Intergenic
1138073362 16:54016073-54016095 AATAACTGCCACCTACCTCATGG - Intronic
1138680451 16:58680167-58680189 CCTTACAACCACATGCCTCAGGG + Exonic
1139443385 16:66980318-66980340 CCTAACACCCACATTGTTCAAGG + Intergenic
1140048943 16:71462369-71462391 CTTACCTGCCCCATTCCCCAGGG - Exonic
1140652160 16:77099872-77099894 GCCAAATGCCACTTTCCTCAAGG + Intergenic
1143118953 17:4595634-4595656 CCTCACACCCACATTCCCCAGGG + Intronic
1144022783 17:11251874-11251896 CCAACCTGCCACACGCCTCAAGG + Intronic
1144774000 17:17775142-17775164 CCTAACCCCCACATTGTTCAAGG - Intronic
1145728819 17:27157249-27157271 CCTGACTTCCAACTTCCTCATGG - Intergenic
1146513319 17:33469333-33469355 GCCTACTGCCCCATTCCTCATGG - Intronic
1147413436 17:40270626-40270648 CCTAAAACCCAGATTCCTCAAGG - Intronic
1148827719 17:50406417-50406439 CCTAAATGCCACCTTCTCCATGG - Intergenic
1149028501 17:52057616-52057638 CCTAATCACCACATTGCTCAAGG + Intronic
1149210238 17:54292594-54292616 CCTAGAGGCCACAATCCTCAGGG + Intergenic
1151675730 17:75596438-75596460 CCTCACTGCCACATGCCCCCAGG + Intergenic
1152910115 17:82999422-82999444 CCTAACCCCCACATTGTTCAGGG - Intronic
1154177959 18:12100080-12100102 CCTAAATCCCACACTACTCAAGG - Intronic
1155025148 18:21934482-21934504 AATAACTGCCAAATTGCTCATGG + Intergenic
1156009884 18:32484590-32484612 CCTAACCTCCACATTGTTCAAGG - Intergenic
1157409363 18:47450741-47450763 CCCAGCTGCCCCATTCCTCCAGG + Intergenic
1157557541 18:48622506-48622528 CCTTGCTCCCACATTCCTCAAGG - Intronic
1158147995 18:54337553-54337575 CCTAACTCCCACATTGTTCAAGG + Intronic
1158461462 18:57649607-57649629 CCTCACAGCCACATTTCTCATGG + Intronic
1158551859 18:58442996-58443018 CCAAACTTCAGCATTCCTCATGG + Intergenic
1158558997 18:58498262-58498284 CCTAACTGCCACCTTCCCCATGG - Intronic
1159235015 18:65660143-65660165 CATAAATGCCACAATACTCATGG + Intergenic
1159979816 18:74764674-74764696 CCTCACTTCCACATTGTTCAAGG - Intronic
1161289427 19:3485105-3485127 CATGGCTCCCACATTCCTCAGGG - Intergenic
1163198760 19:15746722-15746744 CCTTACTGCCATATTGCTAAAGG - Intergenic
1164634512 19:29782387-29782409 CCTGACTACCACTTTCCTGATGG - Intergenic
1165122653 19:33570660-33570682 TCTAACTCTCACACTCCTCAAGG - Intergenic
1167049310 19:47068908-47068930 CCTGACTGCCAGTTTTCTCAGGG + Intronic
1168431054 19:56280921-56280943 CCTAACTCTCACATTGTTCAAGG - Intronic
927182738 2:20458549-20458571 CCTGAATGCACCATTCCTCATGG - Intergenic
927352958 2:22140181-22140203 CCTAACTTGCACATCCCACATGG - Intergenic
927513870 2:23660658-23660680 CCCAACTGCCACCTGCCACAGGG - Intronic
928416699 2:31098628-31098650 CCTAACCCCCACACTGCTCAAGG - Intronic
928635141 2:33237842-33237864 CCTATCTTCCCCTTTCCTCAGGG - Intronic
929112550 2:38417446-38417468 CCTCCCTGACACATTCCACAAGG + Intergenic
929474156 2:42228318-42228340 CCTAACCCCTACATTGCTCAAGG + Intronic
930260093 2:49135619-49135641 CCTAACCTCCACATTGTTCAAGG - Intronic
932840257 2:75075170-75075192 CTTAACTGTCTCTTTCCTCAGGG + Intronic
933439251 2:82290024-82290046 TCTAACTCCCACATTGTTCAAGG + Intergenic
935440063 2:103082571-103082593 CCTTACCGCCACATTCCTGAAGG + Intergenic
936514337 2:113172543-113172565 CCTACCTCCCACTTTCATCATGG + Intronic
938258394 2:129877908-129877930 CCTAACCGCCAGCTTCCTCCGGG - Intergenic
942062530 2:172240921-172240943 CCCCTCTGCCAGATTCCTCAAGG + Intergenic
943488631 2:188520687-188520709 CCTACCTTCCACTATCCTCATGG + Intronic
945007534 2:205424435-205424457 CCTAAATGCCACACTTCCCAAGG - Intronic
945138290 2:206654627-206654649 CCTAACTTTTACATTGCTCAAGG + Intronic
946386261 2:219386223-219386245 ACTGACTGCCACACTCCTCAGGG - Intronic
946504560 2:220284967-220284989 CTTAACTCCCACATTGTTCAAGG - Intergenic
946653491 2:221919579-221919601 CCTGTCTTCCACATTCCTCTTGG - Intergenic
946938954 2:224751238-224751260 CTTATCTGCCAGATTTCTCAGGG - Intergenic
947713607 2:232329314-232329336 CACCACTGCCACATGCCTCAGGG + Intronic
947792063 2:232874003-232874025 CTGACCTGCCACATTCCCCAGGG - Intronic
1170419354 20:16177251-16177273 CCTAACCCCCACATTGTTCAAGG + Intergenic
1170739664 20:19044154-19044176 CATAATTGCCACATGCCTCTAGG - Intergenic
1172858470 20:38027415-38027437 CCTAACCCCCACATTGTTCAAGG - Intronic
1174335866 20:49860184-49860206 GTTGGCTGCCACATTCCTCAAGG + Intronic
1175569055 20:60005328-60005350 CCTAACCCCCACATTGTTCAAGG + Intronic
1178346678 21:31834633-31834655 CCTAACCTCCACATTATTCAAGG + Intergenic
1179331009 21:40401632-40401654 CCAAAGTGCAACAGTCCTCAAGG - Intronic
1180058626 21:45373673-45373695 CCCATCTACCACATTCCCCATGG - Intergenic
1180083567 21:45497553-45497575 CCTCCCTGGCACATTCCTGATGG + Intronic
1180821416 22:18831402-18831424 CATAAATACCACAGTCCTCAAGG + Intergenic
1181020085 22:20095431-20095453 CCTAACTTCCACGTTACTCAAGG - Intronic
1181191562 22:21144643-21144665 CATAAATACCACAGTCCTCAAGG - Intergenic
1181207636 22:21265867-21265889 CATAAATACCACAGTCCTCAAGG + Intergenic
1203219284 22_KI270731v1_random:29549-29571 CATAAATACCACAGTCCTCAAGG - Intergenic
1203271541 22_KI270734v1_random:57278-57300 CATAAATACCACAGTCCTCAAGG + Intergenic
949394360 3:3598812-3598834 CCTAACCCCCACATTATTCAAGG - Intergenic
950327245 3:12122546-12122568 CCTATCTGCCACTTTACTGAGGG - Intronic
950820887 3:15757320-15757342 CCTAACCTCCACATTGTTCAAGG + Intronic
950997740 3:17521589-17521611 CCTAACTCCCATGTTGCTCAAGG + Intronic
951145261 3:19219176-19219198 CCTCACTACCACTGTCCTCATGG + Intronic
952819644 3:37475117-37475139 CCAAACTTCCACATTCCTCCAGG + Intronic
953274442 3:41481184-41481206 CCTAACCCCCACATTGTTCAGGG + Intronic
954097230 3:48338348-48338370 CCCAACTGCCCCTGTCCTCACGG + Intergenic
955473794 3:59314309-59314331 CCTATCTGCCATGTTCCTGATGG - Intergenic
956150597 3:66238194-66238216 CCTAACTGCCAAATTGTTCGAGG - Intronic
957002924 3:74907814-74907836 CCTAACCCCCCCATTGCTCAAGG + Intergenic
959235409 3:103715573-103715595 CCTAACCCCCACATTGTTCAAGG - Intergenic
959256935 3:104027353-104027375 CCTAACCCCCACATTATTCAAGG - Intergenic
959597029 3:108140006-108140028 CCTAACCTCCACATTGTTCAAGG + Intergenic
959603291 3:108213252-108213274 CATAACCCCCACATTGCTCAAGG + Intronic
961244286 3:125437825-125437847 CCTAACAGGCACATTCCTCTGGG - Intergenic
963012659 3:140787540-140787562 CCAAAGTGCCACAATTCTCAAGG - Intergenic
964209479 3:154211222-154211244 CCTAATTGTCACAGTCCTTATGG + Intronic
966505223 3:180693079-180693101 CCTAACAACCACACTCCTTAAGG + Intronic
967232511 3:187353673-187353695 CCTAACCCCCACATTGTTCAAGG - Intergenic
968643789 4:1728499-1728521 CCTCACTGCTGCTTTCCTCAAGG - Exonic
971604080 4:28634967-28634989 CCCAAATGCCAAATTCCTCAGGG + Intergenic
972498246 4:39653710-39653732 CCTAACTGCAAAAATCCTAAAGG + Intergenic
974680372 4:65153277-65153299 CTTAACAGACACATTACTCAGGG - Intergenic
976510069 4:85898309-85898331 ACTAACAGTCACATTCCACAGGG - Intronic
977986110 4:103385339-103385361 CCTGAGTGCATCATTCCTCACGG - Intergenic
979966041 4:127077536-127077558 CCAAAATGCACCATTCCTCACGG + Intergenic
981274316 4:142880087-142880109 CCTCACTGCCACATTTCTAAAGG + Intergenic
982393279 4:154889287-154889309 CCAAACTCCCACATTGTTCAAGG - Intergenic
982769243 4:159380736-159380758 CCTAACTCCCGCATTGTTCAAGG - Intergenic
983142442 4:164168717-164168739 CCTAACCCTCACATTGCTCAAGG - Intronic
983692404 4:170486799-170486821 CCTAACCCCCACATTGTTCAAGG - Intergenic
984856542 4:184200628-184200650 CCTGACTGCCACAGTCCGCAGGG - Intronic
984984384 4:185313707-185313729 CCTAACCCCCACATTGTTCAAGG - Intronic
985060336 4:186071565-186071587 CCTAGCTGTGGCATTCCTCATGG + Intronic
986322754 5:6646403-6646425 CCTACCAACCAAATTCCTCAAGG - Intronic
987963851 5:24847009-24847031 CCTAACCCCCACATTATTCAAGG - Intergenic
988627365 5:32891923-32891945 CCTAAGGGCTACATTCCTAAAGG - Intergenic
989723978 5:44565557-44565579 CCTCACTACCACATTGCTAAAGG - Intergenic
991199850 5:63979335-63979357 CATAACTGCCAGATTCACCAAGG - Intergenic
992284675 5:75222009-75222031 CCTAACTCCCAAATTGTTCAAGG + Intronic
993261871 5:85667976-85667998 CCTAACTCCCACATTGTACAAGG + Intergenic
993517128 5:88851410-88851432 CCTAACCTCCACATTGTTCAAGG + Intronic
993769038 5:91901613-91901635 CCTTAGTGCCACCTACCTCATGG - Intergenic
994130010 5:96216306-96216328 CCTAACCCCCACATTGTTCAAGG + Intergenic
994601306 5:101908926-101908948 CCTAACCTCCACATTGTTCAAGG + Intergenic
995789195 5:115865396-115865418 CCTAACTGCCACATTGTTCAAGG + Intronic
997503598 5:134398092-134398114 CCTAACAGCAACATTCTCCAAGG + Intergenic
999982583 5:156972123-156972145 TCTAAATGCCAGATTCCTGAGGG + Intergenic
1001146967 5:169193373-169193395 CCTAACTGCCAAGCTCCACACGG + Intronic
1001285543 5:170420710-170420732 CCTAACTCCCACATCGTTCAGGG + Intronic
1001350582 5:170959541-170959563 CCTAACTCCCACATTGTTCAAGG - Intronic
1001383746 5:171320973-171320995 CCTAACCCCCACATTGTTCAAGG + Intergenic
1001984797 5:176064199-176064221 CCTAACCCCCACATTATTCATGG - Intronic
1002232715 5:177779994-177780016 CCTAACCCCCACATTATTCATGG + Intronic
1003647151 6:7922360-7922382 CCTAACTCCCACATCGTTCAAGG - Intronic
1004339337 6:14794632-14794654 CCTAACTCCCACACTGTTCAAGG + Intergenic
1007249542 6:40486435-40486457 ACTAACTGCCGAATTCCCCAAGG - Intronic
1008532797 6:52479995-52480017 CCTAACTCCCACATTGTTCAAGG - Intronic
1008840909 6:55903098-55903120 TCTGACTGCCCCAGTCCTCAAGG - Intergenic
1009834170 6:68976437-68976459 CCTAACGGCCACATTATTCAAGG - Intronic
1011162759 6:84410564-84410586 TTTAACAGCCACATTCATCATGG - Intergenic
1012488406 6:99748473-99748495 CCTAACTCCCACATTGTTCAAGG - Intergenic
1015291011 6:131538503-131538525 CCTGAGTGCACCATTCCTCATGG - Intergenic
1015526391 6:134178112-134178134 CCTGAATGCCACGTTCCTCCCGG - Intronic
1015977575 6:138806455-138806477 CCTAACTCCCACATTGGTCAAGG - Intronic
1016436718 6:144045639-144045661 CATAACTGTCAGATTCATCAAGG - Intronic
1017652176 6:156593762-156593784 CCTAACCCCCACATTGTTCAAGG + Intergenic
1017795810 6:157843243-157843265 CCTAACCCCCACATTGTTCAAGG - Intronic
1017858891 6:158376814-158376836 CCTGACAGCCACATTCAACAGGG - Intronic
1018687163 6:166312273-166312295 CCTAACCCCCACATTGCTTAGGG + Intergenic
1021026131 7:15668843-15668865 CCTAACTTCCACATTATTCAAGG + Intronic
1021038220 7:15827934-15827956 GCTAACTGCCACTTACCTTAAGG - Intergenic
1023114636 7:36850457-36850479 CCTAACTCCCATATTGTTCAAGG + Intergenic
1023248157 7:38229353-38229375 CCTCACTGGGACATTTCTCAAGG + Intronic
1023283959 7:38599629-38599651 CCTAACCGCCACATTGTTAAAGG + Intronic
1024212337 7:47216697-47216719 CCAAACTGCCGCCTTCCCCATGG + Intergenic
1024775393 7:52779176-52779198 ACTAACTGCCTCCTTGCTCAGGG + Intergenic
1025809861 7:64868846-64868868 CCTGACTTCCATGTTCCTCATGG + Intergenic
1026274458 7:68864454-68864476 CCTGATTGCCCCATTCCTAATGG - Intergenic
1028290446 7:89058665-89058687 CTTCACTGCCACATTTCTGAGGG - Intronic
1028588104 7:92470960-92470982 CCTGAAGGCCACAGTCCTCAGGG - Exonic
1032079717 7:128852807-128852829 CCTAACACCCACTTTCCACAGGG + Exonic
1033085393 7:138336678-138336700 GCTAACACCCACATTGCTCAAGG + Intergenic
1034303996 7:150036796-150036818 CCTAACACCCACAGTCCTCCAGG + Intergenic
1034304514 7:150038692-150038714 CCTAACACCCACAGTCCTCCAGG + Intergenic
1038441057 8:27571189-27571211 CCTCCCTGCCCCTTTCCTCACGG - Intergenic
1039078122 8:33710750-33710772 GATAAATGACACATTCCTCAGGG + Intergenic
1040437072 8:47401026-47401048 CATAATTGTCACATTCATCAAGG + Intronic
1040636537 8:49280869-49280891 CCTAACTCCTACATTGTTCAAGG - Intergenic
1040775860 8:51042591-51042613 CTCAACTGCCACACTCCCCATGG - Intergenic
1041646453 8:60257566-60257588 CCACACTGCCAGAGTCCTCAGGG + Intronic
1042412944 8:68485178-68485200 CAGAACTGGCACATTACTCATGG - Intronic
1042645131 8:70978686-70978708 CATAACTGCCAGATTCACCAAGG - Intergenic
1043115621 8:76250373-76250395 CCTAACCCCCACATTGTTCAAGG + Intergenic
1043949608 8:86292889-86292911 CCTAACTCCCACAATGTTCAAGG - Intronic
1044131033 8:88525131-88525153 CCTGAATGCACCATTCCTCATGG - Intergenic
1044295499 8:90522364-90522386 CATAATTGCCACCTTCCTGAGGG + Intergenic
1047233529 8:123018400-123018422 GCTAGCTGCCATATTCCTAAAGG - Intronic
1047664049 8:127070526-127070548 CCTAACTCCCACATTACTCAAGG + Intergenic
1047821473 8:128525955-128525977 CCTATCTGCCACAATCTGCAGGG - Intergenic
1048854089 8:138672051-138672073 CCCAACTGTCACATTATTCAGGG + Intronic
1052033238 9:23651743-23651765 CTTAACTACCACATCCCTTAAGG - Intergenic
1055188765 9:73491741-73491763 CCTACCTCCCACATTATTCAAGG - Intergenic
1057059393 9:91989907-91989929 CCTAACTCCCACATTGTTCAAGG - Intergenic
1057246314 9:93457931-93457953 CTTAAATGCCACAATCCTCTTGG + Intronic
1057628803 9:96702165-96702187 TCTCACTGCCACATTACTAAAGG + Intergenic
1057980956 9:99662703-99662725 CCTAACTCCCACATTGTTCAAGG - Intergenic
1060317559 9:122526810-122526832 CCTGACTCACACGTTCCTCATGG - Exonic
1185713489 X:2322881-2322903 CCTAACTCCCACATTGTTCAAGG + Intronic
1186729970 X:12399419-12399441 TCTAACTTCCACATTGTTCAAGG - Intronic
1187061854 X:15794294-15794316 CCTAACTCCCACATTGTTCAAGG - Intronic
1187453128 X:19416843-19416865 CCTAACTCCCACATTGTTCAAGG + Intronic
1187947456 X:24440276-24440298 GCTTACTTCCAAATTCCTCAGGG - Intergenic
1189175896 X:38956937-38956959 CTTAAGTTCCACATTACTCACGG + Intergenic
1189558546 X:42169505-42169527 CCTAACCTCCACATTGTTCAAGG - Intergenic
1189884860 X:45532046-45532068 CCTAACTCCCACATTATTCTAGG + Intergenic
1192747147 X:73950483-73950505 CCTAACCCCCCCATTCCTCAAGG - Intergenic
1193225546 X:78978417-78978439 CATAACTGCCAGATTCACCAAGG - Intergenic
1196155979 X:112430968-112430990 CCTTACTGCTACATTACTAAAGG - Intergenic
1196850123 X:119929672-119929694 CCTAACTGCCACATTCCTCATGG + Intronic
1198303619 X:135356560-135356582 CTTAACCTCCACATTGCTCAAGG - Intronic
1198497804 X:137210815-137210837 CCCATCAGCCACATTCTTCAGGG + Intergenic
1199418407 X:147614303-147614325 CCTAACCTTCACATTGCTCAAGG + Intergenic
1200229941 X:154438836-154438858 CCTGATTCCCAAATTCCTCATGG + Exonic
1200704449 Y:6429722-6429744 CCTGACTTCCATGTTCCTCATGG - Intergenic
1201029662 Y:9734986-9735008 CCTGACTTCCATGTTCCTCATGG + Intergenic
1201407086 Y:13660338-13660360 CCTGAAGGCCACAATCCTCAGGG - Intergenic