ID: 1196861380

View in Genome Browser
Species Human (GRCh38)
Location X:120031644-120031666
Sequence CAAGGTTTACAGAAGGAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196861376_1196861380 -8 Left 1196861376 X:120031629-120031651 CCTCATCATACAAGGCAAGGTTT No data
Right 1196861380 X:120031644-120031666 CAAGGTTTACAGAAGGAGGGAGG No data
1196861373_1196861380 16 Left 1196861373 X:120031605-120031627 CCTGCACTGTGTGATTTATGTTG No data
Right 1196861380 X:120031644-120031666 CAAGGTTTACAGAAGGAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196861380 Original CRISPR CAAGGTTTACAGAAGGAGGG AGG Intergenic
No off target data available for this crispr