ID: 1196862360

View in Genome Browser
Species Human (GRCh38)
Location X:120040193-120040215
Sequence TTATCTCAGCCGAGGTGATG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196862352_1196862360 11 Left 1196862352 X:120040159-120040181 CCCCTCTGCTGGATCTCTTATTT No data
Right 1196862360 X:120040193-120040215 TTATCTCAGCCGAGGTGATGGGG No data
1196862354_1196862360 9 Left 1196862354 X:120040161-120040183 CCTCTGCTGGATCTCTTATTTGA No data
Right 1196862360 X:120040193-120040215 TTATCTCAGCCGAGGTGATGGGG No data
1196862353_1196862360 10 Left 1196862353 X:120040160-120040182 CCCTCTGCTGGATCTCTTATTTG No data
Right 1196862360 X:120040193-120040215 TTATCTCAGCCGAGGTGATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196862360 Original CRISPR TTATCTCAGCCGAGGTGATG GGG Intergenic
No off target data available for this crispr