ID: 1196863876

View in Genome Browser
Species Human (GRCh38)
Location X:120052755-120052777
Sequence GTATGGCAAGGGAGGTTTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196863876_1196863886 26 Left 1196863876 X:120052755-120052777 CCATGAAACCTCCCTTGCCATAC No data
Right 1196863886 X:120052804-120052826 CTATCCTGCGTTACAACTTCAGG No data
1196863876_1196863882 -4 Left 1196863876 X:120052755-120052777 CCATGAAACCTCCCTTGCCATAC No data
Right 1196863882 X:120052774-120052796 ATACCTGGACTGCCTCCTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196863876 Original CRISPR GTATGGCAAGGGAGGTTTCA TGG (reversed) Intergenic
No off target data available for this crispr