ID: 1196863878

View in Genome Browser
Species Human (GRCh38)
Location X:120052763-120052785
Sequence CAGTCCAGGTATGGCAAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196863878_1196863886 18 Left 1196863878 X:120052763-120052785 CCTCCCTTGCCATACCTGGACTG No data
Right 1196863886 X:120052804-120052826 CTATCCTGCGTTACAACTTCAGG No data
1196863878_1196863888 23 Left 1196863878 X:120052763-120052785 CCTCCCTTGCCATACCTGGACTG No data
Right 1196863888 X:120052809-120052831 CTGCGTTACAACTTCAGGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196863878 Original CRISPR CAGTCCAGGTATGGCAAGGG AGG (reversed) Intergenic