ID: 1196863879

View in Genome Browser
Species Human (GRCh38)
Location X:120052766-120052788
Sequence AGGCAGTCCAGGTATGGCAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196863879_1196863886 15 Left 1196863879 X:120052766-120052788 CCCTTGCCATACCTGGACTGCCT No data
Right 1196863886 X:120052804-120052826 CTATCCTGCGTTACAACTTCAGG No data
1196863879_1196863888 20 Left 1196863879 X:120052766-120052788 CCCTTGCCATACCTGGACTGCCT No data
Right 1196863888 X:120052809-120052831 CTGCGTTACAACTTCAGGTGTGG No data
1196863879_1196863889 30 Left 1196863879 X:120052766-120052788 CCCTTGCCATACCTGGACTGCCT No data
Right 1196863889 X:120052819-120052841 ACTTCAGGTGTGGCTCTACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196863879 Original CRISPR AGGCAGTCCAGGTATGGCAA GGG (reversed) Intergenic
No off target data available for this crispr