ID: 1196863880

View in Genome Browser
Species Human (GRCh38)
Location X:120052767-120052789
Sequence GAGGCAGTCCAGGTATGGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196863880_1196863889 29 Left 1196863880 X:120052767-120052789 CCTTGCCATACCTGGACTGCCTC No data
Right 1196863889 X:120052819-120052841 ACTTCAGGTGTGGCTCTACCTGG No data
1196863880_1196863886 14 Left 1196863880 X:120052767-120052789 CCTTGCCATACCTGGACTGCCTC No data
Right 1196863886 X:120052804-120052826 CTATCCTGCGTTACAACTTCAGG No data
1196863880_1196863888 19 Left 1196863880 X:120052767-120052789 CCTTGCCATACCTGGACTGCCTC No data
Right 1196863888 X:120052809-120052831 CTGCGTTACAACTTCAGGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196863880 Original CRISPR GAGGCAGTCCAGGTATGGCA AGG (reversed) Intergenic