ID: 1196863881

View in Genome Browser
Species Human (GRCh38)
Location X:120052772-120052794
Sequence TGTAGGAGGCAGTCCAGGTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196863881_1196863888 14 Left 1196863881 X:120052772-120052794 CCATACCTGGACTGCCTCCTACA No data
Right 1196863888 X:120052809-120052831 CTGCGTTACAACTTCAGGTGTGG No data
1196863881_1196863886 9 Left 1196863881 X:120052772-120052794 CCATACCTGGACTGCCTCCTACA No data
Right 1196863886 X:120052804-120052826 CTATCCTGCGTTACAACTTCAGG No data
1196863881_1196863889 24 Left 1196863881 X:120052772-120052794 CCATACCTGGACTGCCTCCTACA No data
Right 1196863889 X:120052819-120052841 ACTTCAGGTGTGGCTCTACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196863881 Original CRISPR TGTAGGAGGCAGTCCAGGTA TGG (reversed) Intergenic