ID: 1196863882

View in Genome Browser
Species Human (GRCh38)
Location X:120052774-120052796
Sequence ATACCTGGACTGCCTCCTAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196863871_1196863882 29 Left 1196863871 X:120052722-120052744 CCTAAGTTTCAAATTAACAAATC No data
Right 1196863882 X:120052774-120052796 ATACCTGGACTGCCTCCTACAGG No data
1196863874_1196863882 7 Left 1196863874 X:120052744-120052766 CCACAGGGAGCCCATGAAACCTC No data
Right 1196863882 X:120052774-120052796 ATACCTGGACTGCCTCCTACAGG No data
1196863876_1196863882 -4 Left 1196863876 X:120052755-120052777 CCATGAAACCTCCCTTGCCATAC No data
Right 1196863882 X:120052774-120052796 ATACCTGGACTGCCTCCTACAGG No data
1196863875_1196863882 -3 Left 1196863875 X:120052754-120052776 CCCATGAAACCTCCCTTGCCATA No data
Right 1196863882 X:120052774-120052796 ATACCTGGACTGCCTCCTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196863882 Original CRISPR ATACCTGGACTGCCTCCTAC AGG Intergenic
No off target data available for this crispr