ID: 1196863883

View in Genome Browser
Species Human (GRCh38)
Location X:120052777-120052799
Sequence ATACCTGTAGGAGGCAGTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196863883_1196863889 19 Left 1196863883 X:120052777-120052799 CCTGGACTGCCTCCTACAGGTAT No data
Right 1196863889 X:120052819-120052841 ACTTCAGGTGTGGCTCTACCTGG No data
1196863883_1196863886 4 Left 1196863883 X:120052777-120052799 CCTGGACTGCCTCCTACAGGTAT No data
Right 1196863886 X:120052804-120052826 CTATCCTGCGTTACAACTTCAGG No data
1196863883_1196863888 9 Left 1196863883 X:120052777-120052799 CCTGGACTGCCTCCTACAGGTAT No data
Right 1196863888 X:120052809-120052831 CTGCGTTACAACTTCAGGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196863883 Original CRISPR ATACCTGTAGGAGGCAGTCC AGG (reversed) Intergenic