ID: 1196863884

View in Genome Browser
Species Human (GRCh38)
Location X:120052786-120052808
Sequence GATAGAGCTATACCTGTAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196863884_1196863889 10 Left 1196863884 X:120052786-120052808 CCTCCTACAGGTATAGCTCTATC No data
Right 1196863889 X:120052819-120052841 ACTTCAGGTGTGGCTCTACCTGG No data
1196863884_1196863886 -5 Left 1196863884 X:120052786-120052808 CCTCCTACAGGTATAGCTCTATC No data
Right 1196863886 X:120052804-120052826 CTATCCTGCGTTACAACTTCAGG No data
1196863884_1196863888 0 Left 1196863884 X:120052786-120052808 CCTCCTACAGGTATAGCTCTATC No data
Right 1196863888 X:120052809-120052831 CTGCGTTACAACTTCAGGTGTGG No data
1196863884_1196863891 28 Left 1196863884 X:120052786-120052808 CCTCCTACAGGTATAGCTCTATC No data
Right 1196863891 X:120052837-120052859 CCTGGCAGCCTTCTCTCATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196863884 Original CRISPR GATAGAGCTATACCTGTAGG AGG (reversed) Intergenic