ID: 1196863886

View in Genome Browser
Species Human (GRCh38)
Location X:120052804-120052826
Sequence CTATCCTGCGTTACAACTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196863884_1196863886 -5 Left 1196863884 X:120052786-120052808 CCTCCTACAGGTATAGCTCTATC No data
Right 1196863886 X:120052804-120052826 CTATCCTGCGTTACAACTTCAGG No data
1196863883_1196863886 4 Left 1196863883 X:120052777-120052799 CCTGGACTGCCTCCTACAGGTAT No data
Right 1196863886 X:120052804-120052826 CTATCCTGCGTTACAACTTCAGG No data
1196863879_1196863886 15 Left 1196863879 X:120052766-120052788 CCCTTGCCATACCTGGACTGCCT No data
Right 1196863886 X:120052804-120052826 CTATCCTGCGTTACAACTTCAGG No data
1196863885_1196863886 -8 Left 1196863885 X:120052789-120052811 CCTACAGGTATAGCTCTATCCTG No data
Right 1196863886 X:120052804-120052826 CTATCCTGCGTTACAACTTCAGG No data
1196863881_1196863886 9 Left 1196863881 X:120052772-120052794 CCATACCTGGACTGCCTCCTACA No data
Right 1196863886 X:120052804-120052826 CTATCCTGCGTTACAACTTCAGG No data
1196863876_1196863886 26 Left 1196863876 X:120052755-120052777 CCATGAAACCTCCCTTGCCATAC No data
Right 1196863886 X:120052804-120052826 CTATCCTGCGTTACAACTTCAGG No data
1196863878_1196863886 18 Left 1196863878 X:120052763-120052785 CCTCCCTTGCCATACCTGGACTG No data
Right 1196863886 X:120052804-120052826 CTATCCTGCGTTACAACTTCAGG No data
1196863875_1196863886 27 Left 1196863875 X:120052754-120052776 CCCATGAAACCTCCCTTGCCATA No data
Right 1196863886 X:120052804-120052826 CTATCCTGCGTTACAACTTCAGG No data
1196863880_1196863886 14 Left 1196863880 X:120052767-120052789 CCTTGCCATACCTGGACTGCCTC No data
Right 1196863886 X:120052804-120052826 CTATCCTGCGTTACAACTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196863886 Original CRISPR CTATCCTGCGTTACAACTTC AGG Intergenic
No off target data available for this crispr