ID: 1196863889

View in Genome Browser
Species Human (GRCh38)
Location X:120052819-120052841
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196863879_1196863889 30 Left 1196863879 X:120052766-120052788 CCCTTGCCATACCTGGACTGCCT No data
Right 1196863889 X:120052819-120052841 ACTTCAGGTGTGGCTCTACCTGG No data
1196863880_1196863889 29 Left 1196863880 X:120052767-120052789 CCTTGCCATACCTGGACTGCCTC No data
Right 1196863889 X:120052819-120052841 ACTTCAGGTGTGGCTCTACCTGG No data
1196863885_1196863889 7 Left 1196863885 X:120052789-120052811 CCTACAGGTATAGCTCTATCCTG No data
Right 1196863889 X:120052819-120052841 ACTTCAGGTGTGGCTCTACCTGG No data
1196863884_1196863889 10 Left 1196863884 X:120052786-120052808 CCTCCTACAGGTATAGCTCTATC No data
Right 1196863889 X:120052819-120052841 ACTTCAGGTGTGGCTCTACCTGG No data
1196863881_1196863889 24 Left 1196863881 X:120052772-120052794 CCATACCTGGACTGCCTCCTACA No data
Right 1196863889 X:120052819-120052841 ACTTCAGGTGTGGCTCTACCTGG No data
1196863883_1196863889 19 Left 1196863883 X:120052777-120052799 CCTGGACTGCCTCCTACAGGTAT No data
Right 1196863889 X:120052819-120052841 ACTTCAGGTGTGGCTCTACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196863889 Original CRISPR ACTTCAGGTGTGGCTCTACC TGG Intergenic