ID: 1196863891

View in Genome Browser
Species Human (GRCh38)
Location X:120052837-120052859
Sequence CCTGGCAGCCTTCTCTCATT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196863887_1196863891 6 Left 1196863887 X:120052808-120052830 CCTGCGTTACAACTTCAGGTGTG No data
Right 1196863891 X:120052837-120052859 CCTGGCAGCCTTCTCTCATTTGG No data
1196863885_1196863891 25 Left 1196863885 X:120052789-120052811 CCTACAGGTATAGCTCTATCCTG No data
Right 1196863891 X:120052837-120052859 CCTGGCAGCCTTCTCTCATTTGG No data
1196863884_1196863891 28 Left 1196863884 X:120052786-120052808 CCTCCTACAGGTATAGCTCTATC No data
Right 1196863891 X:120052837-120052859 CCTGGCAGCCTTCTCTCATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196863891 Original CRISPR CCTGGCAGCCTTCTCTCATT TGG Intergenic
No off target data available for this crispr