ID: 1196865100

View in Genome Browser
Species Human (GRCh38)
Location X:120064106-120064128
Sequence TCTAGGGAACCCTAATGCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196865095_1196865100 -6 Left 1196865095 X:120064089-120064111 CCTATTTGTTCTGTCCCTCTAGG No data
Right 1196865100 X:120064106-120064128 TCTAGGGAACCCTAATGCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196865100 Original CRISPR TCTAGGGAACCCTAATGCAC TGG Intergenic
No off target data available for this crispr