ID: 1196866779

View in Genome Browser
Species Human (GRCh38)
Location X:120077784-120077806
Sequence AACGCGTGCTCTCCCTCATC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 49
Summary {0: 2, 1: 0, 2: 0, 3: 0, 4: 47}

Found 19 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196866779_1196866801 28 Left 1196866779 X:120077784-120077806 CCGGATGAGGGAGAGCACGCGTT 0: 2
1: 0
2: 0
3: 0
4: 47
Right 1196866801 X:120077835-120077857 TGTAGTAGGGTGTGGGGGAGGGG 0: 2
1: 0
2: 8
3: 206
4: 1645
1196866779_1196866797 22 Left 1196866779 X:120077784-120077806 CCGGATGAGGGAGAGCACGCGTT 0: 2
1: 0
2: 0
3: 0
4: 47
Right 1196866797 X:120077829-120077851 AAGTGGTGTAGTAGGGTGTGGGG 0: 2
1: 0
2: 1
3: 7
4: 183
1196866779_1196866787 -8 Left 1196866779 X:120077784-120077806 CCGGATGAGGGAGAGCACGCGTT 0: 2
1: 0
2: 0
3: 0
4: 47
Right 1196866787 X:120077799-120077821 CACGCGTTGGTGGTGTGGGGGGG 0: 2
1: 0
2: 1
3: 15
4: 176
1196866779_1196866791 -2 Left 1196866779 X:120077784-120077806 CCGGATGAGGGAGAGCACGCGTT 0: 2
1: 0
2: 0
3: 0
4: 47
Right 1196866791 X:120077805-120077827 TTGGTGGTGTGGGGGGGGAGGGG 0: 2
1: 1
2: 13
3: 273
4: 3647
1196866779_1196866795 20 Left 1196866779 X:120077784-120077806 CCGGATGAGGGAGAGCACGCGTT 0: 2
1: 0
2: 0
3: 0
4: 47
Right 1196866795 X:120077827-120077849 GTAAGTGGTGTAGTAGGGTGTGG 0: 2
1: 0
2: 1
3: 12
4: 181
1196866779_1196866790 -3 Left 1196866779 X:120077784-120077806 CCGGATGAGGGAGAGCACGCGTT 0: 2
1: 0
2: 0
3: 0
4: 47
Right 1196866790 X:120077804-120077826 GTTGGTGGTGTGGGGGGGGAGGG 0: 2
1: 0
2: 10
3: 221
4: 1988
1196866779_1196866800 27 Left 1196866779 X:120077784-120077806 CCGGATGAGGGAGAGCACGCGTT 0: 2
1: 0
2: 0
3: 0
4: 47
Right 1196866800 X:120077834-120077856 GTGTAGTAGGGTGTGGGGGAGGG 0: 2
1: 1
2: 1
3: 66
4: 892
1196866779_1196866803 30 Left 1196866779 X:120077784-120077806 CCGGATGAGGGAGAGCACGCGTT 0: 2
1: 0
2: 0
3: 0
4: 47
Right 1196866803 X:120077837-120077859 TAGTAGGGTGTGGGGGAGGGGGG 0: 2
1: 0
2: 12
3: 176
4: 1352
1196866779_1196866802 29 Left 1196866779 X:120077784-120077806 CCGGATGAGGGAGAGCACGCGTT 0: 2
1: 0
2: 0
3: 0
4: 47
Right 1196866802 X:120077836-120077858 GTAGTAGGGTGTGGGGGAGGGGG 0: 2
1: 0
2: 12
3: 260
4: 1974
1196866779_1196866794 15 Left 1196866779 X:120077784-120077806 CCGGATGAGGGAGAGCACGCGTT 0: 2
1: 0
2: 0
3: 0
4: 47
Right 1196866794 X:120077822-120077844 GAGGGGTAAGTGGTGTAGTAGGG 0: 2
1: 0
2: 1
3: 15
4: 106
1196866779_1196866792 5 Left 1196866779 X:120077784-120077806 CCGGATGAGGGAGAGCACGCGTT 0: 2
1: 0
2: 0
3: 0
4: 47
Right 1196866792 X:120077812-120077834 TGTGGGGGGGGAGGGGTAAGTGG 0: 2
1: 0
2: 9
3: 195
4: 2086
1196866779_1196866798 23 Left 1196866779 X:120077784-120077806 CCGGATGAGGGAGAGCACGCGTT 0: 2
1: 0
2: 0
3: 0
4: 47
Right 1196866798 X:120077830-120077852 AGTGGTGTAGTAGGGTGTGGGGG 0: 2
1: 0
2: 2
3: 27
4: 326
1196866779_1196866788 -7 Left 1196866779 X:120077784-120077806 CCGGATGAGGGAGAGCACGCGTT 0: 2
1: 0
2: 0
3: 0
4: 47
Right 1196866788 X:120077800-120077822 ACGCGTTGGTGGTGTGGGGGGGG 0: 2
1: 0
2: 0
3: 13
4: 236
1196866779_1196866796 21 Left 1196866779 X:120077784-120077806 CCGGATGAGGGAGAGCACGCGTT 0: 2
1: 0
2: 0
3: 0
4: 47
Right 1196866796 X:120077828-120077850 TAAGTGGTGTAGTAGGGTGTGGG 0: 2
1: 0
2: 0
3: 6
4: 106
1196866779_1196866789 -4 Left 1196866779 X:120077784-120077806 CCGGATGAGGGAGAGCACGCGTT 0: 2
1: 0
2: 0
3: 0
4: 47
Right 1196866789 X:120077803-120077825 CGTTGGTGGTGTGGGGGGGGAGG 0: 2
1: 0
2: 4
3: 145
4: 2726
1196866779_1196866785 -10 Left 1196866779 X:120077784-120077806 CCGGATGAGGGAGAGCACGCGTT 0: 2
1: 0
2: 0
3: 0
4: 47
Right 1196866785 X:120077797-120077819 AGCACGCGTTGGTGGTGTGGGGG 0: 2
1: 0
2: 0
3: 8
4: 90
1196866779_1196866786 -9 Left 1196866779 X:120077784-120077806 CCGGATGAGGGAGAGCACGCGTT 0: 2
1: 0
2: 0
3: 0
4: 47
Right 1196866786 X:120077798-120077820 GCACGCGTTGGTGGTGTGGGGGG 0: 2
1: 0
2: 2
3: 8
4: 138
1196866779_1196866799 26 Left 1196866779 X:120077784-120077806 CCGGATGAGGGAGAGCACGCGTT 0: 2
1: 0
2: 0
3: 0
4: 47
Right 1196866799 X:120077833-120077855 GGTGTAGTAGGGTGTGGGGGAGG 0: 2
1: 0
2: 5
3: 52
4: 680
1196866779_1196866793 14 Left 1196866779 X:120077784-120077806 CCGGATGAGGGAGAGCACGCGTT 0: 2
1: 0
2: 0
3: 0
4: 47
Right 1196866793 X:120077821-120077843 GGAGGGGTAAGTGGTGTAGTAGG 0: 2
1: 0
2: 0
3: 15
4: 232

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196866779 Original CRISPR AACGCGTGCTCTCCCTCATC CGG (reversed) Intergenic