ID: 1196866779

View in Genome Browser
Species Human (GRCh38)
Location X:120077784-120077806
Sequence AACGCGTGCTCTCCCTCATC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 49
Summary {0: 2, 1: 0, 2: 0, 3: 0, 4: 47}

Found 19 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196866779_1196866787 -8 Left 1196866779 X:120077784-120077806 CCGGATGAGGGAGAGCACGCGTT 0: 2
1: 0
2: 0
3: 0
4: 47
Right 1196866787 X:120077799-120077821 CACGCGTTGGTGGTGTGGGGGGG 0: 2
1: 0
2: 1
3: 15
4: 176
1196866779_1196866785 -10 Left 1196866779 X:120077784-120077806 CCGGATGAGGGAGAGCACGCGTT 0: 2
1: 0
2: 0
3: 0
4: 47
Right 1196866785 X:120077797-120077819 AGCACGCGTTGGTGGTGTGGGGG 0: 2
1: 0
2: 0
3: 8
4: 90
1196866779_1196866790 -3 Left 1196866779 X:120077784-120077806 CCGGATGAGGGAGAGCACGCGTT 0: 2
1: 0
2: 0
3: 0
4: 47
Right 1196866790 X:120077804-120077826 GTTGGTGGTGTGGGGGGGGAGGG 0: 2
1: 0
2: 10
3: 221
4: 1988
1196866779_1196866799 26 Left 1196866779 X:120077784-120077806 CCGGATGAGGGAGAGCACGCGTT 0: 2
1: 0
2: 0
3: 0
4: 47
Right 1196866799 X:120077833-120077855 GGTGTAGTAGGGTGTGGGGGAGG 0: 2
1: 0
2: 5
3: 52
4: 680
1196866779_1196866788 -7 Left 1196866779 X:120077784-120077806 CCGGATGAGGGAGAGCACGCGTT 0: 2
1: 0
2: 0
3: 0
4: 47
Right 1196866788 X:120077800-120077822 ACGCGTTGGTGGTGTGGGGGGGG 0: 2
1: 0
2: 0
3: 13
4: 236
1196866779_1196866791 -2 Left 1196866779 X:120077784-120077806 CCGGATGAGGGAGAGCACGCGTT 0: 2
1: 0
2: 0
3: 0
4: 47
Right 1196866791 X:120077805-120077827 TTGGTGGTGTGGGGGGGGAGGGG 0: 2
1: 1
2: 13
3: 273
4: 3647
1196866779_1196866800 27 Left 1196866779 X:120077784-120077806 CCGGATGAGGGAGAGCACGCGTT 0: 2
1: 0
2: 0
3: 0
4: 47
Right 1196866800 X:120077834-120077856 GTGTAGTAGGGTGTGGGGGAGGG 0: 2
1: 1
2: 1
3: 66
4: 892
1196866779_1196866796 21 Left 1196866779 X:120077784-120077806 CCGGATGAGGGAGAGCACGCGTT 0: 2
1: 0
2: 0
3: 0
4: 47
Right 1196866796 X:120077828-120077850 TAAGTGGTGTAGTAGGGTGTGGG 0: 2
1: 0
2: 0
3: 6
4: 106
1196866779_1196866792 5 Left 1196866779 X:120077784-120077806 CCGGATGAGGGAGAGCACGCGTT 0: 2
1: 0
2: 0
3: 0
4: 47
Right 1196866792 X:120077812-120077834 TGTGGGGGGGGAGGGGTAAGTGG 0: 2
1: 0
2: 9
3: 195
4: 2086
1196866779_1196866803 30 Left 1196866779 X:120077784-120077806 CCGGATGAGGGAGAGCACGCGTT 0: 2
1: 0
2: 0
3: 0
4: 47
Right 1196866803 X:120077837-120077859 TAGTAGGGTGTGGGGGAGGGGGG 0: 2
1: 0
2: 12
3: 176
4: 1352
1196866779_1196866798 23 Left 1196866779 X:120077784-120077806 CCGGATGAGGGAGAGCACGCGTT 0: 2
1: 0
2: 0
3: 0
4: 47
Right 1196866798 X:120077830-120077852 AGTGGTGTAGTAGGGTGTGGGGG 0: 2
1: 0
2: 2
3: 27
4: 326
1196866779_1196866802 29 Left 1196866779 X:120077784-120077806 CCGGATGAGGGAGAGCACGCGTT 0: 2
1: 0
2: 0
3: 0
4: 47
Right 1196866802 X:120077836-120077858 GTAGTAGGGTGTGGGGGAGGGGG 0: 2
1: 0
2: 12
3: 260
4: 1974
1196866779_1196866789 -4 Left 1196866779 X:120077784-120077806 CCGGATGAGGGAGAGCACGCGTT 0: 2
1: 0
2: 0
3: 0
4: 47
Right 1196866789 X:120077803-120077825 CGTTGGTGGTGTGGGGGGGGAGG 0: 2
1: 0
2: 4
3: 145
4: 2726
1196866779_1196866786 -9 Left 1196866779 X:120077784-120077806 CCGGATGAGGGAGAGCACGCGTT 0: 2
1: 0
2: 0
3: 0
4: 47
Right 1196866786 X:120077798-120077820 GCACGCGTTGGTGGTGTGGGGGG 0: 2
1: 0
2: 2
3: 8
4: 138
1196866779_1196866793 14 Left 1196866779 X:120077784-120077806 CCGGATGAGGGAGAGCACGCGTT 0: 2
1: 0
2: 0
3: 0
4: 47
Right 1196866793 X:120077821-120077843 GGAGGGGTAAGTGGTGTAGTAGG 0: 2
1: 0
2: 0
3: 15
4: 232
1196866779_1196866795 20 Left 1196866779 X:120077784-120077806 CCGGATGAGGGAGAGCACGCGTT 0: 2
1: 0
2: 0
3: 0
4: 47
Right 1196866795 X:120077827-120077849 GTAAGTGGTGTAGTAGGGTGTGG 0: 2
1: 0
2: 1
3: 12
4: 181
1196866779_1196866794 15 Left 1196866779 X:120077784-120077806 CCGGATGAGGGAGAGCACGCGTT 0: 2
1: 0
2: 0
3: 0
4: 47
Right 1196866794 X:120077822-120077844 GAGGGGTAAGTGGTGTAGTAGGG 0: 2
1: 0
2: 1
3: 15
4: 106
1196866779_1196866797 22 Left 1196866779 X:120077784-120077806 CCGGATGAGGGAGAGCACGCGTT 0: 2
1: 0
2: 0
3: 0
4: 47
Right 1196866797 X:120077829-120077851 AAGTGGTGTAGTAGGGTGTGGGG 0: 2
1: 0
2: 1
3: 7
4: 183
1196866779_1196866801 28 Left 1196866779 X:120077784-120077806 CCGGATGAGGGAGAGCACGCGTT 0: 2
1: 0
2: 0
3: 0
4: 47
Right 1196866801 X:120077835-120077857 TGTAGTAGGGTGTGGGGGAGGGG 0: 2
1: 0
2: 8
3: 206
4: 1645

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196866779 Original CRISPR AACGCGTGCTCTCCCTCATC CGG (reversed) Intergenic
905358359 1:37400761-37400783 GCCGCGTGCTATCCATCATCCGG + Intergenic
908743598 1:67354245-67354267 CACACCTGCTCTCCCTCACCTGG - Intronic
912649671 1:111426641-111426663 AATGTGTGCTCTCCCTTACCAGG - Exonic
920364238 1:205439716-205439738 TAAGCCTGTTCTCCCTCATCAGG - Intronic
1063581939 10:7316113-7316135 AACGCATGACCTCCCTCAACAGG + Intronic
1064584741 10:16828821-16828843 AACGCCAGCTCTCCATCCTCTGG - Exonic
1078618884 11:12889670-12889692 AACGTGTGCCTTCCCTGATCGGG - Intronic
1088708013 11:112481103-112481125 AACTCATGCACTCCCACATCTGG - Intergenic
1089995700 11:122905150-122905172 AATGCCTTCTCTTCCTCATCAGG + Intronic
1090344808 11:126061822-126061844 AATGCCTGCCCTTCCTCATCAGG - Intronic
1090863387 11:130673836-130673858 AAGGCCTGCTCTCCTTCCTCTGG + Intronic
1093803837 12:23408172-23408194 AAAGCCTTCTCTCTCTCATCAGG - Intergenic
1099615078 12:84923909-84923931 AATGCCTGCTCTCCCACATGTGG + Intergenic
1102581249 12:113889486-113889508 GACACATGGTCTCCCTCATCTGG + Intronic
1113462857 13:110493852-110493874 AGCGGGTGCTCTCCCTCGTGAGG - Intronic
1137694450 16:50452129-50452151 CACCCTTGGTCTCCCTCATCAGG + Intergenic
1140466903 16:75189886-75189908 AACAGTTGCTCTCCCTCACCTGG - Intergenic
1150639461 17:66939677-66939699 AAGGGGTGCTCTCCCTCCTGCGG - Intergenic
1150917684 17:69453092-69453114 AACTCCTGCTCTGCGTCATCAGG - Intronic
1159526451 18:69597747-69597769 AACGCCTGCTCAACCTCAGCTGG + Intronic
1166069703 19:40379845-40379867 AGCACATGCTCACCCTCATCAGG - Intronic
932793468 2:74675217-74675239 ACCGCGTACTCACCTTCATCCGG + Exonic
934941042 2:98502189-98502211 AAGGAATGCTCTCTCTCATCTGG - Intronic
1175092660 20:56517821-56517843 AACGCAGGCCCTGCCTCATCAGG + Intronic
1179642845 21:42758668-42758690 AACGGGTGCACTCTCTCACCCGG + Intronic
1180669392 22:17541674-17541696 CACACGTGCTCACCCGCATCAGG - Intronic
1184565179 22:45287499-45287521 TGCCCCTGCTCTCCCTCATCAGG - Intronic
962456170 3:135567496-135567518 GACACGTGCTCTCCCTCACATGG - Intergenic
968727366 4:2253984-2254006 AAAGCGTGCTCTCTCTGCTCAGG + Intronic
975389161 4:73796557-73796579 ACCGCATGCTCTCACTCATAAGG + Intergenic
977876980 4:102161887-102161909 AGCTCTTGCTGTCCCTCATCAGG - Intergenic
985127387 4:186708338-186708360 TACCCGTTCTCACCCTCATCAGG + Exonic
1003264563 6:4553968-4553990 AACGGCTGAACTCCCTCATCTGG + Intergenic
1004593794 6:17079667-17079689 ACCGCATGTTCTCCCTCATAAGG + Intergenic
1012969312 6:105710551-105710573 AACTCCTGCTCTCCTTCATGGGG - Intergenic
1019325225 7:434862-434884 AACGGCTGCTCTTCCCCATCCGG - Intergenic
1023039297 7:36158302-36158324 CACCCATCCTCTCCCTCATCAGG + Intronic
1026493211 7:70881014-70881036 ATCCTGTGGTCTCCCTCATCAGG - Intergenic
1037753822 8:21698978-21699000 AACGCACTCTCTCCCTCTTCTGG + Intronic
1050670931 9:7996476-7996498 AACGCGTGACCTACCTCACCCGG + Intergenic
1059405285 9:114095332-114095354 AACTCTTGCTCTCCCTCCCCAGG - Exonic
1060189336 9:121582220-121582242 AAAGCTTGCTCTCCCCCAGCCGG - Intronic
1062591016 9:137274736-137274758 CACGGCTGCTCTCCCTCACCTGG - Intergenic
1196866779 X:120077784-120077806 AACGCGTGCTCTCCCTCATCCGG - Intergenic
1196876320 X:120158497-120158519 AACGCGTGCTCTCCCTCATCCGG + Intergenic
1200251619 X:154557181-154557203 AACGCGTGGCCTCCCGCTTCTGG + Intronic
1200253826 X:154568865-154568887 AACGCGTGGCCTCCCGCTTCTGG + Intergenic
1200263943 X:154635543-154635565 AACGCGTGGCCTCCCGCTTCTGG - Intergenic
1200266148 X:154647235-154647257 AACGCGTGGCCTCCCGCTTCTGG - Intergenic