ID: 1196867000

View in Genome Browser
Species Human (GRCh38)
Location X:120078993-120079015
Sequence AGATATCTGTAGAAAAGGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196867000_1196867003 -4 Left 1196867000 X:120078993-120079015 CCTGCCCTTTTCTACAGATATCT No data
Right 1196867003 X:120079012-120079034 ATCTTTCTGAGCTCTTGTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196867000 Original CRISPR AGATATCTGTAGAAAAGGGC AGG (reversed) Intergenic
No off target data available for this crispr