ID: 1196867003

View in Genome Browser
Species Human (GRCh38)
Location X:120079012-120079034
Sequence ATCTTTCTGAGCTCTTGTTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196866999_1196867003 4 Left 1196866999 X:120078985-120079007 CCTCTACTCCTGCCCTTTTCTAC No data
Right 1196867003 X:120079012-120079034 ATCTTTCTGAGCTCTTGTTTAGG No data
1196867000_1196867003 -4 Left 1196867000 X:120078993-120079015 CCTGCCCTTTTCTACAGATATCT No data
Right 1196867003 X:120079012-120079034 ATCTTTCTGAGCTCTTGTTTAGG No data
1196867001_1196867003 -8 Left 1196867001 X:120078997-120079019 CCCTTTTCTACAGATATCTTTCT No data
Right 1196867003 X:120079012-120079034 ATCTTTCTGAGCTCTTGTTTAGG No data
1196866998_1196867003 12 Left 1196866998 X:120078977-120078999 CCTCTTTTCCTCTACTCCTGCCC No data
Right 1196867003 X:120079012-120079034 ATCTTTCTGAGCTCTTGTTTAGG No data
1196866996_1196867003 28 Left 1196866996 X:120078961-120078983 CCTGCTGCTGCATAGCCCTCTTT No data
Right 1196867003 X:120079012-120079034 ATCTTTCTGAGCTCTTGTTTAGG No data
1196867002_1196867003 -9 Left 1196867002 X:120078998-120079020 CCTTTTCTACAGATATCTTTCTG No data
Right 1196867003 X:120079012-120079034 ATCTTTCTGAGCTCTTGTTTAGG No data
1196866997_1196867003 13 Left 1196866997 X:120078976-120078998 CCCTCTTTTCCTCTACTCCTGCC No data
Right 1196867003 X:120079012-120079034 ATCTTTCTGAGCTCTTGTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196867003 Original CRISPR ATCTTTCTGAGCTCTTGTTT AGG Intergenic
No off target data available for this crispr