ID: 1196867395

View in Genome Browser
Species Human (GRCh38)
Location X:120082786-120082808
Sequence AGGCTGGTCAGTCTACGCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196867395_1196867399 -4 Left 1196867395 X:120082786-120082808 CCTGTGCGTAGACTGACCAGCCT No data
Right 1196867399 X:120082805-120082827 GCCTCCGGTGTGGTCAGAGCAGG No data
1196867395_1196867405 24 Left 1196867395 X:120082786-120082808 CCTGTGCGTAGACTGACCAGCCT No data
Right 1196867405 X:120082833-120082855 TGTCCTTCTTACCGGTAGTTGGG No data
1196867395_1196867404 23 Left 1196867395 X:120082786-120082808 CCTGTGCGTAGACTGACCAGCCT No data
Right 1196867404 X:120082832-120082854 TTGTCCTTCTTACCGGTAGTTGG No data
1196867395_1196867401 -3 Left 1196867395 X:120082786-120082808 CCTGTGCGTAGACTGACCAGCCT No data
Right 1196867401 X:120082806-120082828 CCTCCGGTGTGGTCAGAGCAGGG No data
1196867395_1196867403 16 Left 1196867395 X:120082786-120082808 CCTGTGCGTAGACTGACCAGCCT No data
Right 1196867403 X:120082825-120082847 AGGGCAGTTGTCCTTCTTACCGG 0: 10
1: 2
2: 8
3: 9
4: 98

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196867395 Original CRISPR AGGCTGGTCAGTCTACGCAC AGG (reversed) Intergenic
No off target data available for this crispr