ID: 1196867399

View in Genome Browser
Species Human (GRCh38)
Location X:120082805-120082827
Sequence GCCTCCGGTGTGGTCAGAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196867395_1196867399 -4 Left 1196867395 X:120082786-120082808 CCTGTGCGTAGACTGACCAGCCT No data
Right 1196867399 X:120082805-120082827 GCCTCCGGTGTGGTCAGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196867399 Original CRISPR GCCTCCGGTGTGGTCAGAGC AGG Intergenic
No off target data available for this crispr