ID: 1196867998

View in Genome Browser
Species Human (GRCh38)
Location X:120086726-120086748
Sequence GGGCCTAAAAAGATGGAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196867987_1196867998 7 Left 1196867987 X:120086696-120086718 CCTATTTCCATAGAGACCATAGG No data
Right 1196867998 X:120086726-120086748 GGGCCTAAAAAGATGGAGCCTGG No data
1196867989_1196867998 0 Left 1196867989 X:120086703-120086725 CCATAGAGACCATAGGCTCCCCG 0: 5
1: 2
2: 6
3: 7
4: 58
Right 1196867998 X:120086726-120086748 GGGCCTAAAAAGATGGAGCCTGG No data
1196867983_1196867998 21 Left 1196867983 X:120086682-120086704 CCATTAATTGACCCCCTATTTCC No data
Right 1196867998 X:120086726-120086748 GGGCCTAAAAAGATGGAGCCTGG No data
1196867993_1196867998 -9 Left 1196867993 X:120086712-120086734 CCATAGGCTCCCCGGGGCCTAAA 0: 4
1: 0
2: 5
3: 14
4: 93
Right 1196867998 X:120086726-120086748 GGGCCTAAAAAGATGGAGCCTGG No data
1196867985_1196867998 9 Left 1196867985 X:120086694-120086716 CCCCTATTTCCATAGAGACCATA No data
Right 1196867998 X:120086726-120086748 GGGCCTAAAAAGATGGAGCCTGG No data
1196867984_1196867998 10 Left 1196867984 X:120086693-120086715 CCCCCTATTTCCATAGAGACCAT No data
Right 1196867998 X:120086726-120086748 GGGCCTAAAAAGATGGAGCCTGG No data
1196867986_1196867998 8 Left 1196867986 X:120086695-120086717 CCCTATTTCCATAGAGACCATAG No data
Right 1196867998 X:120086726-120086748 GGGCCTAAAAAGATGGAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196867998 Original CRISPR GGGCCTAAAAAGATGGAGCC TGG Intergenic
No off target data available for this crispr