ID: 1196869240

View in Genome Browser
Species Human (GRCh38)
Location X:120097063-120097085
Sequence GAGGGGAGCCAATAGGGAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196869235_1196869240 -7 Left 1196869235 X:120097047-120097069 CCCATGCAGGACTCCGGAGGGGA No data
Right 1196869240 X:120097063-120097085 GAGGGGAGCCAATAGGGAGTAGG No data
1196869230_1196869240 5 Left 1196869230 X:120097035-120097057 CCACTTAGAGCACCCATGCAGGA No data
Right 1196869240 X:120097063-120097085 GAGGGGAGCCAATAGGGAGTAGG No data
1196869236_1196869240 -8 Left 1196869236 X:120097048-120097070 CCATGCAGGACTCCGGAGGGGAG No data
Right 1196869240 X:120097063-120097085 GAGGGGAGCCAATAGGGAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196869240 Original CRISPR GAGGGGAGCCAATAGGGAGT AGG Intergenic
No off target data available for this crispr