ID: 1196875105

View in Genome Browser
Species Human (GRCh38)
Location X:120149555-120149577
Sequence GGGCCTAAAAAGATGGAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196875105_1196875120 21 Left 1196875105 X:120149555-120149577 CCAGGCTCCATCTTTTTAGGCCC No data
Right 1196875120 X:120149599-120149621 GGAAATAGGGGGTCAATTAATGG No data
1196875105_1196875117 8 Left 1196875105 X:120149555-120149577 CCAGGCTCCATCTTTTTAGGCCC No data
Right 1196875117 X:120149586-120149608 CTATGGTCTCTATGGAAATAGGG No data
1196875105_1196875110 -9 Left 1196875105 X:120149555-120149577 CCAGGCTCCATCTTTTTAGGCCC No data
Right 1196875110 X:120149569-120149591 TTTAGGCCCCGGGGAGCCTATGG 0: 4
1: 0
2: 5
3: 14
4: 93
1196875105_1196875114 0 Left 1196875105 X:120149555-120149577 CCAGGCTCCATCTTTTTAGGCCC No data
Right 1196875114 X:120149578-120149600 CGGGGAGCCTATGGTCTCTATGG 0: 5
1: 2
2: 6
3: 7
4: 58
1196875105_1196875116 7 Left 1196875105 X:120149555-120149577 CCAGGCTCCATCTTTTTAGGCCC No data
Right 1196875116 X:120149585-120149607 CCTATGGTCTCTATGGAAATAGG No data
1196875105_1196875118 9 Left 1196875105 X:120149555-120149577 CCAGGCTCCATCTTTTTAGGCCC No data
Right 1196875118 X:120149587-120149609 TATGGTCTCTATGGAAATAGGGG No data
1196875105_1196875119 10 Left 1196875105 X:120149555-120149577 CCAGGCTCCATCTTTTTAGGCCC No data
Right 1196875119 X:120149588-120149610 ATGGTCTCTATGGAAATAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196875105 Original CRISPR GGGCCTAAAAAGATGGAGCC TGG (reversed) Intergenic
No off target data available for this crispr