ID: 1196875109

View in Genome Browser
Species Human (GRCh38)
Location X:120149562-120149584
Sequence CTCCCCGGGGCCTAAAAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196875109_1196875120 14 Left 1196875109 X:120149562-120149584 CCATCTTTTTAGGCCCCGGGGAG No data
Right 1196875120 X:120149599-120149621 GGAAATAGGGGGTCAATTAATGG No data
1196875109_1196875116 0 Left 1196875109 X:120149562-120149584 CCATCTTTTTAGGCCCCGGGGAG No data
Right 1196875116 X:120149585-120149607 CCTATGGTCTCTATGGAAATAGG No data
1196875109_1196875118 2 Left 1196875109 X:120149562-120149584 CCATCTTTTTAGGCCCCGGGGAG No data
Right 1196875118 X:120149587-120149609 TATGGTCTCTATGGAAATAGGGG No data
1196875109_1196875117 1 Left 1196875109 X:120149562-120149584 CCATCTTTTTAGGCCCCGGGGAG No data
Right 1196875117 X:120149586-120149608 CTATGGTCTCTATGGAAATAGGG No data
1196875109_1196875119 3 Left 1196875109 X:120149562-120149584 CCATCTTTTTAGGCCCCGGGGAG No data
Right 1196875119 X:120149588-120149610 ATGGTCTCTATGGAAATAGGGGG No data
1196875109_1196875121 24 Left 1196875109 X:120149562-120149584 CCATCTTTTTAGGCCCCGGGGAG No data
Right 1196875121 X:120149609-120149631 GGTCAATTAATGGATTTTTTTGG No data
1196875109_1196875114 -7 Left 1196875109 X:120149562-120149584 CCATCTTTTTAGGCCCCGGGGAG No data
Right 1196875114 X:120149578-120149600 CGGGGAGCCTATGGTCTCTATGG 0: 5
1: 2
2: 6
3: 7
4: 58

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196875109 Original CRISPR CTCCCCGGGGCCTAAAAAGA TGG (reversed) Intergenic
No off target data available for this crispr