ID: 1196875110

View in Genome Browser
Species Human (GRCh38)
Location X:120149569-120149591
Sequence TTTAGGCCCCGGGGAGCCTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 116
Summary {0: 4, 1: 0, 2: 5, 3: 14, 4: 93}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196875105_1196875110 -9 Left 1196875105 X:120149555-120149577 CCAGGCTCCATCTTTTTAGGCCC No data
Right 1196875110 X:120149569-120149591 TTTAGGCCCCGGGGAGCCTATGG 0: 4
1: 0
2: 5
3: 14
4: 93
1196875102_1196875110 17 Left 1196875102 X:120149529-120149551 CCGAGAATTTTGAGGACTGAGAC 0: 3
1: 1
2: 0
3: 20
4: 216
Right 1196875110 X:120149569-120149591 TTTAGGCCCCGGGGAGCCTATGG 0: 4
1: 0
2: 5
3: 14
4: 93

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196875110 Original CRISPR TTTAGGCCCCGGGGAGCCTA TGG Intergenic
902617374 1:17631138-17631160 TTTATGTCCCGGGGAGGCTCGGG + Intronic
902977544 1:20099843-20099865 TTAAGCCCCAGGGGAGCCTTTGG - Intergenic
903627175 1:24739595-24739617 TTTAGGGGACCGGGAGCCTACGG + Intergenic
903647237 1:24902803-24902825 GGGAGGCCCCGGGCAGCCTAGGG - Intronic
904442591 1:30541324-30541346 TGAAGGCCCAGGGGAGCCTTAGG - Intergenic
907256085 1:53180212-53180234 CTAAGGACCAGGGGAGCCTATGG - Intergenic
909319051 1:74259276-74259298 TTGAGAACCAGGGGAGCCTATGG + Intronic
921703179 1:218290363-218290385 TTTAGGCTCCTGTGAGCCTCTGG + Intronic
1067004521 10:42648217-42648239 ATTAGGCCCTGAGGAGCCCATGG + Intergenic
1069732397 10:70625855-70625877 TTTTGGCCAAGGGGATCCTAGGG + Intergenic
1071549659 10:86556979-86557001 TTTATGCCCAGGGGAGGCAACGG - Intergenic
1073290906 10:102412829-102412851 TGTAGGCCCCTGGGAGCTTGAGG - Intronic
1076904624 10:133355870-133355892 TTTGGGCCCTGGGGAGTCCAGGG - Intronic
1077293937 11:1815312-1815334 CTGAGGCCCTGGGGAGGCTACGG + Intergenic
1081977907 11:47247567-47247589 TTTTGCCCTCAGGGAGCCTAAGG - Intronic
1082627522 11:55502669-55502691 TTTTAGGCCCGGGGAGCCTATGG + Intergenic
1083331028 11:61898465-61898487 TTTGGGGGCCGGGGACCCTAGGG - Intronic
1083511179 11:63210644-63210666 TTTAGGCCATGGGGAGCCTATGG + Intronic
1084554226 11:69866150-69866172 TGTAGGCCCCAAGGAGCCTCTGG - Intergenic
1088888330 11:114025023-114025045 TTTAGGAACCAGGCAGCCTAGGG - Intergenic
1092280243 12:7092662-7092684 TTTAGGGCCCGGGGAGCCTTGGG + Intronic
1094809617 12:34124556-34124578 TTTAGGCCCCGGGGAGCCTATGG - Intergenic
1094841498 12:34344367-34344389 GTGAAGCCCCGGGGACCCTAGGG - Intergenic
1095298657 12:40556799-40556821 TTTAGGTCCTGGAGAGCCCAAGG - Intronic
1103231576 12:119335241-119335263 TTTATGCCTCGGAGAACCTAAGG + Exonic
1104921577 12:132293331-132293353 TCTGGGCTCCGGGGAGCCTCTGG + Intronic
1106241915 13:27919932-27919954 GTGGGGCCCCGCGGAGCCTATGG + Intergenic
1108114083 13:47108911-47108933 ATTAGGCCCGGAGGAGCCTATGG - Intergenic
1109727083 13:66355742-66355764 GTTAGGCCCCTGTGAGCCTGTGG - Intronic
1116937343 14:50755259-50755281 TTTAGGCCCCTGGGTACCTAGGG + Intronic
1118469397 14:66061187-66061209 TTTAGGCCCAGGGGAGATGATGG + Intergenic
1122156886 14:99755283-99755305 TGGAGGCCCCGGGGAGCCTGGGG + Intronic
1122183614 14:99972341-99972363 CTTAGGCTCCGGGGGGCCTGCGG + Intronic
1122802612 14:104239203-104239225 TTTAGGCTCTGGGGAGGCCATGG + Intergenic
1124584246 15:30991174-30991196 TTGAGGCCCAGGGGAGCCTTGGG - Intronic
1128454937 15:67827067-67827089 TTTAGGCGCGGGCGAGCCAAAGG + Exonic
1132459381 16:43098-43120 TTTAGGCCCCAGGGAGCCTGTGG + Intergenic
1132761188 16:1509340-1509362 CTGGGGCCCCGGGGAGCCTTGGG - Intronic
1135148405 16:19983854-19983876 GGTAGGCCCTGGGGAGTCTATGG + Intergenic
1141448710 16:84081823-84081845 TGTTGACCCCGGGGAGCCTCCGG + Exonic
1143076923 17:4352149-4352171 CTTAGGTCCTGGGGAGCCTGTGG - Intronic
1151194144 17:72420094-72420116 TTGAGGCACCGGGGTGCTTATGG - Intergenic
1154504589 18:15022497-15022519 TTTAGGCCCCTGGGTGCCAATGG + Intergenic
1155419552 18:25640130-25640152 TTTAGACCATGGGGAGCGTACGG + Intergenic
1160909734 19:1469009-1469031 TTTGGGCACCGGGGAGGCTCCGG - Exonic
1164825199 19:31279684-31279706 TTTAGACCCAGAGGAGCATACGG - Exonic
1168675982 19:58278558-58278580 TTTAGGCACCGGGGAGCAGAGGG + Intronic
925155449 2:1645909-1645931 TTTAGACTCTGGTGAGCCTAAGG - Intronic
925456902 2:4023652-4023674 TGTAGGCCCCTGGCAGCCTTTGG - Intergenic
931234900 2:60405157-60405179 TTTAGTCCCCGGGAACCCTGAGG + Intergenic
936076050 2:109402527-109402549 TGTAGGCACCGAGGAGCCTGGGG - Intronic
937626919 2:124054392-124054414 TATAGGACCCTAGGAGCCTAGGG - Intronic
938164619 2:129016043-129016065 TTCAGGCCCAGGGGAGCAAATGG - Intergenic
941105156 2:161343710-161343732 TTTAGCTCCTCGGGAGCCTAAGG + Intronic
945167331 2:206959917-206959939 TTTAGGCCTAAGGAAGCCTAAGG + Intronic
948988313 2:241539577-241539599 TCTAGGCCCCTGGGACCCCAAGG - Intergenic
1169216598 20:3797750-3797772 GTGAGGCCCAGGGGAGCCTGGGG + Intronic
1176874962 21:14118238-14118260 ATTAGGCCCCAAGGAGCCTATGG + Intronic
1177992645 21:28057443-28057465 TTTAGGCCCATGGGTGCCAATGG - Intergenic
1179376174 21:40851563-40851585 GTTGGGCACCGGGGAGCCTCTGG + Intergenic
1179522704 21:41955462-41955484 TTTAGGCCCCGGAGAATCTCAGG - Intergenic
1182417122 22:30228747-30228769 TTTAGGCACCGGGGAACATGGGG - Intergenic
1185126073 22:49011571-49011593 TGCCGGCCCCGGGGAGCCTGTGG + Intergenic
1185414812 22:50704227-50704249 TTTGTGCTCCGGGGAGCCAAAGG + Intergenic
950032631 3:9862664-9862686 TTGAGGCCCCGGGGACCCAGCGG + Intergenic
950142031 3:10622127-10622149 GGTGGGCCCAGGGGAGCCTAGGG - Intronic
952944977 3:38473135-38473157 ATTAGGCCCCTTGGAGCATAGGG + Intronic
953875721 3:46665742-46665764 TCTATGCCTCCGGGAGCCTAGGG - Intergenic
954172987 3:48820184-48820206 TTTAGGCACTGTGGAGCCAATGG + Intronic
955073124 3:55588441-55588463 CTTAGGCCCCGGTAAGCCGAAGG + Intronic
957690587 3:83561328-83561350 TTACGGCCCCGTGGAGTCTAAGG - Intergenic
960761160 3:121075043-121075065 ATTAGGCCCCAAGGAGCCTATGG - Intronic
961785353 3:129344006-129344028 TTGAGGCCCCGGGGACCCAACGG + Intergenic
961869447 3:129977076-129977098 TGTGGGCCCCAGGGAGCCTATGG + Exonic
970572926 4:17400313-17400335 TTCTGGCCCCAGGGAGCCTTTGG - Intergenic
970580322 4:17468964-17468986 TTTAGGCAACGGGGAACCTCTGG - Intronic
971218881 4:24686984-24687006 TTTAGGCTCTGGGGAGACAAAGG - Intergenic
974977042 4:68904777-68904799 TTTGGGACCCGAGGAGCCCATGG - Intergenic
985591440 5:767364-767386 TGTTGGCCCCGGGGAGCCCTTGG - Intergenic
985609358 5:878327-878349 TGTCGGCCCCGGGGAGCCCTTGG - Intronic
994185545 5:96811060-96811082 TCTAAGGCCCTGGGAGCCTATGG - Intergenic
998205079 5:140152234-140152256 GCAAGGCCCCGGGGGGCCTAAGG + Intergenic
1007188837 6:39996513-39996535 TTCAGGCCCTCAGGAGCCTATGG - Intergenic
1009494264 6:64329093-64329115 ATTAGGCCCCGAGGAGCCTATGG + Intronic
1013412127 6:109891840-109891862 CTTAGGCCCCCAGGAGCCCATGG - Intergenic
1018533242 6:164790323-164790345 TTCAGGTCCTGGGGAGCCTGAGG - Intergenic
1018910692 6:168099665-168099687 CTTAGGCCCCGAGAAGACTAAGG - Intergenic
1021220768 7:17973094-17973116 GATAGGCCCAGGGGAGCCGAAGG - Intergenic
1025824102 7:64996864-64996886 TTTAGCCCCCCAGGAGCCCATGG - Intronic
1031300758 7:120059045-120059067 CTTAGGCCCCCAGGAGCCCATGG - Intergenic
1033092567 7:138399887-138399909 TTTAGGCCCCCAGGACCCAAGGG - Intergenic
1033109694 7:138563153-138563175 CTTAGGCCCCCAGGAGCCCATGG - Intronic
1039510559 8:38088706-38088728 ATTAGGCCCTGAGGAGCCCATGG - Intergenic
1041012611 8:53559202-53559224 TTCAGGGCCTGGGGAGCCCAAGG + Intergenic
1043378852 8:79681421-79681443 TTTAGTCCCTGGGAAGACTACGG - Intergenic
1045763449 8:105638263-105638285 TTTAGGCCCCAGGCTGACTATGG - Intronic
1056803006 9:89707125-89707147 TTTGGGCCCCGGGAAGAATAAGG - Intergenic
1058358100 9:104106997-104107019 CTTAGGACCCGGGGAGCCAGAGG + Intronic
1060770055 9:126326482-126326504 CTCAGGCCCCCGGGAGCCCACGG - Intergenic
1061358928 9:130128469-130128491 TTTAGGCCTCGGCAAGTCTAAGG + Intronic
1061370196 9:130193571-130193593 TTTGGGCCACGTGGAGCCTGAGG + Intronic
1187273230 X:17797666-17797688 TTGTGGCCCCAGTGAGCCTAGGG - Intergenic
1190342766 X:49310649-49310671 TTTAGGCCCCGGGGAGCCTATGG + Intronic
1190651872 X:52575831-52575853 ACTGGGCCCCGAGGAGCCTATGG - Intergenic
1190745833 X:53321246-53321268 TTGAGGGCCCGGGGGCCCTAGGG + Exonic
1194946708 X:100077226-100077248 GTTAGACCCAGGAGAGCCTATGG + Intergenic
1196740824 X:119024374-119024396 TTTAGGCTTCTGGGAGTCTAGGG - Intergenic
1196867993 X:120086712-120086734 TTTAGGCCCCGGGGAGCCTATGG - Intergenic
1196875110 X:120149569-120149591 TTTAGGCCCCGGGGAGCCTATGG + Intergenic
1198469527 X:136933380-136933402 TTTAGGCTCCCAGGAGCCCATGG - Intergenic
1200779112 Y:7198373-7198395 TCTAGGCCCCTGGGAGCCTATGG + Intergenic
1201277814 Y:12314918-12314940 TTTAGGCCTTGTGGAGCCTATGG + Intergenic
1201357703 Y:13114225-13114247 TTTAGGCCTTGTGGAGCCTATGG + Intergenic
1201377847 Y:13341662-13341684 ATTAGGCCCTGAGGAACCTACGG + Intronic
1201896362 Y:18996835-18996857 ATTAGGCCCGGAGGAGCCTATGG + Intergenic
1202095727 Y:21246663-21246685 TTTGGGCCACCAGGAGCCTATGG - Intergenic