ID: 1196875114

View in Genome Browser
Species Human (GRCh38)
Location X:120149578-120149600
Sequence CGGGGAGCCTATGGTCTCTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 78
Summary {0: 5, 1: 2, 2: 6, 3: 7, 4: 58}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196875105_1196875114 0 Left 1196875105 X:120149555-120149577 CCAGGCTCCATCTTTTTAGGCCC No data
Right 1196875114 X:120149578-120149600 CGGGGAGCCTATGGTCTCTATGG 0: 5
1: 2
2: 6
3: 7
4: 58
1196875102_1196875114 26 Left 1196875102 X:120149529-120149551 CCGAGAATTTTGAGGACTGAGAC 0: 3
1: 1
2: 0
3: 20
4: 216
Right 1196875114 X:120149578-120149600 CGGGGAGCCTATGGTCTCTATGG 0: 5
1: 2
2: 6
3: 7
4: 58
1196875109_1196875114 -7 Left 1196875109 X:120149562-120149584 CCATCTTTTTAGGCCCCGGGGAG No data
Right 1196875114 X:120149578-120149600 CGGGGAGCCTATGGTCTCTATGG 0: 5
1: 2
2: 6
3: 7
4: 58

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196875114 Original CRISPR CGGGGAGCCTATGGTCTCTA TGG Intergenic
902282412 1:15384180-15384202 CAGGGAGCCTGTGGTCTGCAAGG - Intronic
903865248 1:26392968-26392990 TGGGCAGCCTATGGTCACTGGGG + Intergenic
920313484 1:205061980-205062002 CGGGGAGCCTCTGGCCTCCCAGG + Exonic
923057611 1:230438987-230439009 CGGGGAGCATGTGGCCTCTGTGG - Intergenic
1067004524 10:42648226-42648248 TGAGGAGCCCATGGTCTCAATGG + Intergenic
1067499101 10:46786195-46786217 CGGGGCGCCTGTGGTCCCTGTGG - Intergenic
1070327351 10:75397299-75397321 CAGGGACCCTCTGGTCCCTAGGG - Intergenic
1074436701 10:113440428-113440450 CAGGGAGCCCAGGGTCTCTTTGG - Intergenic
1075897975 10:126014264-126014286 TAAGGAGCCTATGGTCTCCACGG - Exonic
1076337088 10:129714109-129714131 CGGGGCGCCTAGGGGCTCTGCGG - Intronic
1082627525 11:55502678-55502700 CGGGGAGCCTATGGTCTCTATGG + Intergenic
1083511181 11:63210653-63210675 TGGGGAGCCTATGGTGTCTATGG + Intronic
1084031974 11:66486620-66486642 CGGGGAGCTTATGTTCTCTCTGG + Exonic
1085512080 11:77093504-77093526 CGGGGAGCAGATGGGCCCTATGG + Intronic
1090389715 11:126381163-126381185 AGGGGAGCAGCTGGTCTCTAAGG - Intronic
1090904845 11:131066044-131066066 CGTGGAGTTTGTGGTCTCTAGGG - Intergenic
1094809613 12:34124547-34124569 CGGGGAGCCTATGGTCTCTATGG - Intergenic
1097598486 12:61663941-61663963 AGGGGCGGCTGTGGTCTCTACGG - Intergenic
1101797823 12:107992191-107992213 GGGGGAGGCAATGGCCTCTAGGG - Intergenic
1104653010 12:130550804-130550826 CAGGGAGCTTATGGTCTCCTTGG + Intronic
1108114080 13:47108902-47108924 GGAGGAGCCTATGGTCTCAATGG - Intergenic
1118350537 14:64970378-64970400 AGGGGAGCCTATAGACACTAAGG - Intronic
1126812006 15:52416360-52416382 AAGGGAAACTATGGTCTCTATGG + Intronic
1129062226 15:72869239-72869261 CTGGGAGCAGATGGTGTCTATGG - Intergenic
1132459385 16:43107-43129 CAGGGAGCCTGTGGTCTCTATGG + Intergenic
1137595761 16:49722488-49722510 CAGGGACCCTCTGGGCTCTAGGG - Intronic
1145994581 17:29098036-29098058 GGGGGAGCCAATGGGCACTAGGG + Intronic
1147438324 17:40431515-40431537 CTGGGAGGCTAGGGTCTCTGAGG + Intergenic
1152610822 17:81314339-81314361 CGGGGAGGTTATGGTCTGGAGGG - Intronic
1154109084 18:11550569-11550591 CCAGGAGCCTATGGTCTCAGTGG - Intergenic
1156514089 18:37665422-37665444 CTGAGAGGCTATGCTCTCTATGG - Intergenic
1156739297 18:40304620-40304642 CTGGGAGCCAAGGCTCTCTATGG + Intergenic
1163151580 19:15418343-15418365 CGGGGAGCCTTGGGCCCCTAGGG - Intronic
1164011097 19:21204023-21204045 GGGGGTGGCTATGGTTTCTATGG - Intergenic
1164015914 19:21255915-21255937 AGGGGAGCCTATGGTCTCTATGG + Intronic
927824796 2:26300776-26300798 CGGGGAGCCTATAGTCTCTATGG + Intergenic
929992331 2:46800860-46800882 CGGGCAGCCCAGGCTCTCTAGGG + Intergenic
931926706 2:67081390-67081412 GGTTGGGCCTATGGTCTCTAGGG - Intergenic
938648269 2:133353326-133353348 CTGGGAGCAGAGGGTCTCTAAGG - Intronic
942093901 2:172520077-172520099 CGGGAATCTTATGGACTCTATGG + Intergenic
948840173 2:240644934-240644956 CGGGGAGCCAGTCGTCTCTGTGG + Intergenic
956480041 3:69664186-69664208 CGGGGAGCTTAAAGCCTCTAAGG - Intergenic
960761156 3:121075034-121075056 CAAGGAGCCTATGGTCTCAATGG - Intronic
969297697 4:6279477-6279499 CGTGGAGCCTGTGCTCACTATGG + Intronic
974626192 4:64431241-64431263 CAGGGAGCTTATGCTCTCTCTGG + Intergenic
981870258 4:149477329-149477351 CTGGGAGGCTATGATCTCTCAGG + Intergenic
986997431 5:13623256-13623278 CAGGGAACTTAAGGTCTCTAGGG - Intergenic
990813289 5:59753056-59753078 TGCGGACCCTATGGTCTCTGGGG - Intronic
994321600 5:98401161-98401183 CAGGGACCCTCTGGTCTCCAGGG + Intergenic
994773542 5:104014425-104014447 CGGGGTGCCTATGCTCTGCATGG + Intergenic
997362988 5:133306837-133306859 CAGGGAGCCTGTGGTCCCTGAGG + Intronic
998037982 5:138932691-138932713 CGGGGAGCTTGTTGTCTCTGGGG + Exonic
1000986347 5:167864955-167864977 CGTGGAACATATGTTCTCTAAGG + Intronic
1001009764 5:168086934-168086956 AGGGGAGCCTCTGCTCTCTAGGG - Intronic
1001143716 5:169166207-169166229 GGGGGAGTCTTTGGTCTCCATGG - Intronic
1008001804 6:46368075-46368097 TGTGGAGCATATTGTCTCTATGG + Intronic
1009494268 6:64329102-64329124 CGAGGAGCCTATGGTCTCAATGG + Intronic
1013470769 6:110461727-110461749 CAGGGGGCCAAGGGTCTCTATGG - Intronic
1023017568 7:35982797-35982819 CGTGGGGCCTCTGGTCTCTTAGG + Intergenic
1023873486 7:44274977-44274999 CAGGGAGGCGATGGTCTTTAGGG + Intronic
1024819586 7:53311596-53311618 CGGGGAGCAGATGTTCTCTGTGG + Intergenic
1027254933 7:76425195-76425217 CTGTGAGCCTCTGGTCTCCATGG + Exonic
1032088069 7:128894002-128894024 CGGGGAGCCTGTGGGCTCAGGGG - Exonic
1032456787 7:132079262-132079284 TGTGGATCATATGGTCTCTAAGG - Intergenic
1039510556 8:38088697-38088719 TGAGGAGCCCATGGTCTCAATGG - Intergenic
1048112893 8:131487327-131487349 CGGGGAGGCTATGGCCACTCAGG - Intergenic
1050652085 9:7786841-7786863 CTGGGAGCTTATGGTCTGTGGGG - Intergenic
1190342770 X:49310658-49310680 CGGGGAGCCTATGGTCTCTATGG + Intronic
1190651868 X:52575822-52575844 CGAGGAGCCTATGGTCTCAATGG - Intergenic
1196867989 X:120086703-120086725 CGGGGAGCCTATGGTCTCTATGG - Intergenic
1196875114 X:120149578-120149600 CGGGGAGCCTATGGTCTCTATGG + Intergenic
1200779116 Y:7198382-7198404 CTGGGAGCCTATGGTCACAATGG + Intergenic
1201277816 Y:12314927-12314949 TGTGGAGCCTATGGTCTCTATGG + Intergenic
1201357705 Y:13114234-13114256 TGTGGAGCCTATGGTCTCTATGG + Intergenic
1201755565 Y:17482543-17482565 CAGGGAGCCTATATTCTCCATGG - Intergenic
1201845987 Y:18423442-18423464 CAGGGAGCCTATATTCTCCATGG + Intergenic
1201896365 Y:18996844-18996866 GGAGGAGCCTATGGTCTCAATGG + Intergenic
1202052579 Y:20796503-20796525 CCGGGAGCCCTTGGTCTCTATGG - Intergenic