ID: 1196875116

View in Genome Browser
Species Human (GRCh38)
Location X:120149585-120149607
Sequence CCTATGGTCTCTATGGAAAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196875105_1196875116 7 Left 1196875105 X:120149555-120149577 CCAGGCTCCATCTTTTTAGGCCC No data
Right 1196875116 X:120149585-120149607 CCTATGGTCTCTATGGAAATAGG No data
1196875109_1196875116 0 Left 1196875109 X:120149562-120149584 CCATCTTTTTAGGCCCCGGGGAG No data
Right 1196875116 X:120149585-120149607 CCTATGGTCTCTATGGAAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196875116 Original CRISPR CCTATGGTCTCTATGGAAAT AGG Intergenic
No off target data available for this crispr