ID: 1196875118 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | X:120149587-120149609 |
Sequence | TATGGTCTCTATGGAAATAG GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1196875109_1196875118 | 2 | Left | 1196875109 | X:120149562-120149584 | CCATCTTTTTAGGCCCCGGGGAG | No data | ||
Right | 1196875118 | X:120149587-120149609 | TATGGTCTCTATGGAAATAGGGG | No data | ||||
1196875105_1196875118 | 9 | Left | 1196875105 | X:120149555-120149577 | CCAGGCTCCATCTTTTTAGGCCC | No data | ||
Right | 1196875118 | X:120149587-120149609 | TATGGTCTCTATGGAAATAGGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1196875118 | Original CRISPR | TATGGTCTCTATGGAAATAG GGG | Intergenic | ||
No off target data available for this crispr |