ID: 1196875118

View in Genome Browser
Species Human (GRCh38)
Location X:120149587-120149609
Sequence TATGGTCTCTATGGAAATAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196875109_1196875118 2 Left 1196875109 X:120149562-120149584 CCATCTTTTTAGGCCCCGGGGAG No data
Right 1196875118 X:120149587-120149609 TATGGTCTCTATGGAAATAGGGG No data
1196875105_1196875118 9 Left 1196875105 X:120149555-120149577 CCAGGCTCCATCTTTTTAGGCCC No data
Right 1196875118 X:120149587-120149609 TATGGTCTCTATGGAAATAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196875118 Original CRISPR TATGGTCTCTATGGAAATAG GGG Intergenic
No off target data available for this crispr