ID: 1196875119 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | X:120149588-120149610 |
| Sequence | ATGGTCTCTATGGAAATAGG GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1196875109_1196875119 | 3 | Left | 1196875109 | X:120149562-120149584 | CCATCTTTTTAGGCCCCGGGGAG | No data | ||
| Right | 1196875119 | X:120149588-120149610 | ATGGTCTCTATGGAAATAGGGGG | No data | ||||
| 1196875105_1196875119 | 10 | Left | 1196875105 | X:120149555-120149577 | CCAGGCTCCATCTTTTTAGGCCC | No data | ||
| Right | 1196875119 | X:120149588-120149610 | ATGGTCTCTATGGAAATAGGGGG | No data | ||||
| 1196875111_1196875119 | -10 | Left | 1196875111 | X:120149575-120149597 | CCCCGGGGAGCCTATGGTCTCTA | 0: 4 1: 1 2: 6 3: 11 4: 67 |
||
| Right | 1196875119 | X:120149588-120149610 | ATGGTCTCTATGGAAATAGGGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1196875119 | Original CRISPR | ATGGTCTCTATGGAAATAGG GGG | Intergenic | ||
| No off target data available for this crispr | |||||