ID: 1196875119

View in Genome Browser
Species Human (GRCh38)
Location X:120149588-120149610
Sequence ATGGTCTCTATGGAAATAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196875109_1196875119 3 Left 1196875109 X:120149562-120149584 CCATCTTTTTAGGCCCCGGGGAG No data
Right 1196875119 X:120149588-120149610 ATGGTCTCTATGGAAATAGGGGG No data
1196875105_1196875119 10 Left 1196875105 X:120149555-120149577 CCAGGCTCCATCTTTTTAGGCCC No data
Right 1196875119 X:120149588-120149610 ATGGTCTCTATGGAAATAGGGGG No data
1196875111_1196875119 -10 Left 1196875111 X:120149575-120149597 CCCCGGGGAGCCTATGGTCTCTA 0: 4
1: 1
2: 6
3: 11
4: 67
Right 1196875119 X:120149588-120149610 ATGGTCTCTATGGAAATAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196875119 Original CRISPR ATGGTCTCTATGGAAATAGG GGG Intergenic
No off target data available for this crispr