ID: 1196875120

View in Genome Browser
Species Human (GRCh38)
Location X:120149599-120149621
Sequence GGAAATAGGGGGTCAATTAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196875109_1196875120 14 Left 1196875109 X:120149562-120149584 CCATCTTTTTAGGCCCCGGGGAG No data
Right 1196875120 X:120149599-120149621 GGAAATAGGGGGTCAATTAATGG No data
1196875113_1196875120 -1 Left 1196875113 X:120149577-120149599 CCGGGGAGCCTATGGTCTCTATG 0: 5
1: 2
2: 4
3: 22
4: 98
Right 1196875120 X:120149599-120149621 GGAAATAGGGGGTCAATTAATGG No data
1196875112_1196875120 0 Left 1196875112 X:120149576-120149598 CCCGGGGAGCCTATGGTCTCTAT 0: 5
1: 1
2: 5
3: 12
4: 95
Right 1196875120 X:120149599-120149621 GGAAATAGGGGGTCAATTAATGG No data
1196875115_1196875120 -9 Left 1196875115 X:120149585-120149607 CCTATGGTCTCTATGGAAATAGG No data
Right 1196875120 X:120149599-120149621 GGAAATAGGGGGTCAATTAATGG No data
1196875105_1196875120 21 Left 1196875105 X:120149555-120149577 CCAGGCTCCATCTTTTTAGGCCC No data
Right 1196875120 X:120149599-120149621 GGAAATAGGGGGTCAATTAATGG No data
1196875111_1196875120 1 Left 1196875111 X:120149575-120149597 CCCCGGGGAGCCTATGGTCTCTA 0: 4
1: 1
2: 6
3: 11
4: 67
Right 1196875120 X:120149599-120149621 GGAAATAGGGGGTCAATTAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196875120 Original CRISPR GGAAATAGGGGGTCAATTAA TGG Intergenic
No off target data available for this crispr