ID: 1196875700

View in Genome Browser
Species Human (GRCh38)
Location X:120153477-120153499
Sequence GCCTCCGGTGTGGTCAGAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196875700_1196875704 -4 Left 1196875700 X:120153477-120153499 CCTGCTCTGACCACACCGGAGGC No data
Right 1196875704 X:120153496-120153518 AGGCTGGTCAGTCTACGCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196875700 Original CRISPR GCCTCCGGTGTGGTCAGAGC AGG (reversed) Intergenic
No off target data available for this crispr