ID: 1196876096

View in Genome Browser
Species Human (GRCh38)
Location X:120157270-120157292
Sequence ATCTTTCTGAGCTCTTGTTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196876096_1196876102 13 Left 1196876096 X:120157270-120157292 CCTAAACAAGAGCTCAGAAAGAT No data
Right 1196876102 X:120157306-120157328 GGCAGGAGTAGAGGAAAAGAGGG No data
1196876096_1196876100 4 Left 1196876096 X:120157270-120157292 CCTAAACAAGAGCTCAGAAAGAT No data
Right 1196876100 X:120157297-120157319 GTAGAAAAGGGCAGGAGTAGAGG No data
1196876096_1196876097 -9 Left 1196876096 X:120157270-120157292 CCTAAACAAGAGCTCAGAAAGAT No data
Right 1196876097 X:120157284-120157306 CAGAAAGATATCTGTAGAAAAGG No data
1196876096_1196876103 28 Left 1196876096 X:120157270-120157292 CCTAAACAAGAGCTCAGAAAGAT No data
Right 1196876103 X:120157321-120157343 AAAGAGGGCTATGCAGCAGCAGG No data
1196876096_1196876099 -4 Left 1196876096 X:120157270-120157292 CCTAAACAAGAGCTCAGAAAGAT No data
Right 1196876099 X:120157289-120157311 AGATATCTGTAGAAAAGGGCAGG No data
1196876096_1196876098 -8 Left 1196876096 X:120157270-120157292 CCTAAACAAGAGCTCAGAAAGAT No data
Right 1196876098 X:120157285-120157307 AGAAAGATATCTGTAGAAAAGGG No data
1196876096_1196876101 12 Left 1196876096 X:120157270-120157292 CCTAAACAAGAGCTCAGAAAGAT No data
Right 1196876101 X:120157305-120157327 GGGCAGGAGTAGAGGAAAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196876096 Original CRISPR ATCTTTCTGAGCTCTTGTTT AGG (reversed) Intergenic
No off target data available for this crispr