ID: 1196876099

View in Genome Browser
Species Human (GRCh38)
Location X:120157289-120157311
Sequence AGATATCTGTAGAAAAGGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196876096_1196876099 -4 Left 1196876096 X:120157270-120157292 CCTAAACAAGAGCTCAGAAAGAT No data
Right 1196876099 X:120157289-120157311 AGATATCTGTAGAAAAGGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196876099 Original CRISPR AGATATCTGTAGAAAAGGGC AGG Intergenic
No off target data available for this crispr