ID: 1196876296

View in Genome Browser
Species Human (GRCh38)
Location X:120158444-120158466
Sequence TAGTAGGGTGTGGGGGAGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1542
Summary {0: 2, 1: 0, 2: 12, 3: 176, 4: 1352}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196876296_1196876320 30 Left 1196876296 X:120158444-120158466 CCCCCCTCCCCCACACCCTACTA 0: 2
1: 0
2: 12
3: 176
4: 1352
Right 1196876320 X:120158497-120158519 AACGCGTGCTCTCCCTCATCCGG 0: 2
1: 0
2: 0
3: 0
4: 47

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196876296 Original CRISPR TAGTAGGGTGTGGGGGAGGG GGG (reversed) Intergenic
900083552 1:876088-876110 GTGTGGGGTGTGGGGGAGTGTGG - Intergenic
900083571 1:876155-876177 GTGTGGGGTGTGGGGGAGTGTGG - Intergenic
900140533 1:1137783-1137805 TGGGAGGGAGAGGGGGAGGGAGG - Intergenic
900630955 1:3634947-3634969 GAGCAGGCTGTTGGGGAGGGCGG - Intronic
900685453 1:3945135-3945157 TAGGAGGCTGCGAGGGAGGGAGG + Intergenic
900747416 1:4370466-4370488 TAGTTGTGTGTGGGGGAGAGTGG + Intergenic
900902088 1:5523963-5523985 AAATAGGTTTTGGGGGAGGGAGG + Intergenic
900998634 1:6136335-6136357 GAGCAGGGTGTTGGGGTGGGTGG - Intronic
901005106 1:6167825-6167847 GAGCAGGGAGTGGGGCAGGGAGG + Intronic
901012902 1:6211158-6211180 CACTGGGGTGTGGGGGAGGGTGG + Intronic
901061801 1:6475192-6475214 AAGGAGGGTGGGGAGGAGGGCGG - Intronic
901325897 1:8364902-8364924 CGGTGGGGTGGGGGGGAGGGGGG + Intronic
901483244 1:9540084-9540106 GAGAAGGGGGCGGGGGAGGGGGG - Intronic
901631497 1:10650334-10650356 TAAAAGGGGATGGGGGAGGGGGG - Intronic
901644126 1:10707524-10707546 TGGTCGGGGGTGGAGGAGGGAGG + Intronic
901867683 1:12117843-12117865 TAGAAGGGTGAGGGGGTGGGAGG - Intronic
901959750 1:12816258-12816280 TGGTGGGGTCGGGGGGAGGGGGG - Intergenic
902005502 1:13228833-13228855 TGGGAGGCTGAGGGGGAGGGTGG - Intergenic
902145198 1:14392741-14392763 GAGGCGGGTGTGGGGGTGGGGGG + Intergenic
902694778 1:18132907-18132929 GTGGAGGGAGTGGGGGAGGGAGG + Intronic
902761788 1:18585887-18585909 TTGCAGGGAGTGGGGGTGGGGGG + Intergenic
903290834 1:22313337-22313359 TGAGAGGGTGTGGAGGAGGGAGG - Intergenic
903331669 1:22599926-22599948 AGGGAGGGAGTGGGGGAGGGAGG + Intronic
903670136 1:25030725-25030747 CAGCAAGGTGTGGCGGAGGGAGG - Intergenic
903846795 1:26283691-26283713 TAGCAATGTGTGGGTGAGGGAGG + Intronic
903909513 1:26712296-26712318 AAGTAGGGGGTGAGGGAGAGAGG - Intronic
904054231 1:27659731-27659753 AAGGAGGGTGAGAGGGAGGGTGG + Intergenic
904406744 1:30295900-30295922 TAGTAAGGGGTGGGGGAGGTGGG + Intergenic
904466177 1:30708904-30708926 TGGCAGGGGGTGGGGGTGGGGGG - Intergenic
904535771 1:31198617-31198639 AAGTAGGGTGGAGGGCAGGGGGG - Intronic
904548815 1:31298015-31298037 CAGTGGGGTGTGGTGGAGGAGGG + Intronic
904563051 1:31411603-31411625 TAGTGGGTTGGGGGTGAGGGTGG + Intronic
904649784 1:31996366-31996388 TCGTTGGGGGTGGGGGAGGCGGG - Intergenic
904767151 1:32858948-32858970 TAGTGGGGTGGGGAGGGGGGCGG + Intergenic
905013489 1:34762142-34762164 TAGCAGGGTGGTGAGGAGGGTGG + Exonic
905109565 1:35585406-35585428 AAGTGGGCTGTGGGGGAGGTTGG - Intronic
905160413 1:36028389-36028411 TTGTGGGGTGGGGGGGGGGGAGG - Intronic
905441009 1:37996624-37996646 TTGCAGGGTGGGGTGGAGGGGGG - Intergenic
905738003 1:40344034-40344056 TAGAGGGGTGTGGTGGGGGGGGG - Intergenic
905802520 1:40854314-40854336 TAGTGGGGGGCGGGGGCGGGGGG - Intergenic
905807718 1:40888892-40888914 TAGTGGGGTGAGGGGAGGGGAGG - Intergenic
905842875 1:41199725-41199747 CAATAGGGGGTGGGGGTGGGAGG + Intronic
906117865 1:43367724-43367746 GACGGGGGTGTGGGGGAGGGAGG + Exonic
906319974 1:44809756-44809778 CAGGAGGGTGTGGGGGTGTGGGG - Intronic
906392185 1:45427770-45427792 GTGTGGGGTGTGGGGGAGTGGGG + Intronic
906810088 1:48817776-48817798 TATCAGGATGTGTGGGAGGGAGG - Intronic
906945946 1:50294379-50294401 TGGGAGGGAGTGTGGGAGGGAGG - Intergenic
906969390 1:50495241-50495263 CAGTGGGGTGTGGGGGAAGGTGG - Intronic
906993023 1:50759295-50759317 TTGTGGGGTGGGGGGGAGGGGGG - Intronic
907328028 1:53653604-53653626 CAGTGGGGTGAGGGGGAGGAGGG - Intronic
907331767 1:53676396-53676418 TGCCAGGGTGTGGGGGAGGCGGG - Intronic
907837696 1:58126602-58126624 TTGTGGGGTGGGGGGTAGGGGGG - Intronic
908095962 1:60738873-60738895 TTGTGGGGTGGGGGGGAGGGGGG + Intergenic
908096400 1:60743313-60743335 TTGTGGGGTGGGGGGGAGGGGGG + Intergenic
908472641 1:64459107-64459129 GAGGAGGGTGTGGGGAGGGGTGG + Intergenic
909020764 1:70428214-70428236 TACTAGAGTCTGGGGAAGGGAGG + Intronic
909053657 1:70797289-70797311 TGTTGGGGGGTGGGGGAGGGGGG + Intergenic
909086181 1:71172390-71172412 TTTTAGGGTGTGGAGGATGGTGG + Intergenic
909138629 1:71834444-71834466 TGGCAGGGGGTGGGGGTGGGTGG - Intronic
909472173 1:76041064-76041086 CAGTCAGGAGTGGGGGAGGGCGG + Intergenic
909576325 1:77180701-77180723 TAGAAGTGGGTGGGGGTGGGGGG + Intronic
909707589 1:78605707-78605729 TAGCAGGGTGTGGTGGTGGTGGG + Intergenic
909778256 1:79511402-79511424 TTGTGGGGTGGGGGGGAGGAGGG - Intergenic
910083127 1:83365633-83365655 TAGGTGGGTGGGGGTGAGGGTGG + Intergenic
910328532 1:86040460-86040482 TTGTAGGGGTGGGGGGAGGGGGG - Intronic
910509291 1:87985427-87985449 TAGGAGGGAGGGAGGGAGGGAGG - Intergenic
910576984 1:88776194-88776216 GGGTAGGGGGAGGGGGAGGGAGG - Intronic
910655835 1:89617075-89617097 TAGTGGTGTATGGGAGAGGGAGG - Intergenic
910836564 1:91518742-91518764 TGGGAGGGTGTGGGGGATGTGGG + Intronic
910882174 1:91931591-91931613 TAGCTGGGTGTGGTGGTGGGTGG + Intergenic
911174309 1:94803966-94803988 TGGTGGGGCATGGGGGAGGGAGG - Intergenic
911193459 1:94970863-94970885 TCGGAGGGTGTGGGGGAGGTTGG - Intergenic
911317299 1:96370716-96370738 AAGTGGGGGGTGGGGGGGGGGGG - Intergenic
911728985 1:101272195-101272217 TTGTGGGGTAGGGGGGAGGGGGG - Intergenic
912150122 1:106848502-106848524 TAGAAGGGTATGGGAGAGGTGGG + Intergenic
912170551 1:107094156-107094178 GAGTAGGCTGAGGGGAAGGGAGG - Intergenic
912256538 1:108064936-108064958 TAGTAGTATGTGGGGAATGGAGG - Intergenic
912391666 1:109307153-109307175 AAGTAGGGGTTGGGGGAGAGAGG + Intergenic
912640546 1:111341204-111341226 TTGTGGGGTGGGGGGAAGGGGGG + Intergenic
912822895 1:112881952-112881974 TAGTGGAGTGTGGGAGGGGGTGG + Intergenic
913272937 1:117111792-117111814 TAGCTGGGTGTGGGGGAAGGTGG + Exonic
913337116 1:117718600-117718622 TAGTGGGGTGGGAGGGTGGGAGG - Intergenic
913474226 1:119221413-119221435 CTGTAGGGTGTGGGGGAGGAGGG - Intergenic
914337776 1:146731381-146731403 TTGTGGGGTCGGGGGGAGGGGGG - Intergenic
914341338 1:146762916-146762938 GGGTTGGGTTTGGGGGAGGGGGG + Intergenic
914401182 1:147321940-147321962 TTGTGGGGTGGGGGGGAGGGGGG - Intergenic
914422492 1:147541917-147541939 GAGGAGGGTGTGAGGGTGGGAGG + Intronic
914677639 1:149916829-149916851 TGGTAGGATGTGGGGAGGGGAGG - Intronic
915118685 1:153615524-153615546 GAGCAGGGGGTGGGGGAGAGGGG - Intronic
915250474 1:154584749-154584771 TACTAGGGTGTGAGAGAGGTAGG - Exonic
915320419 1:155053109-155053131 TAGAATGGGGTGGGGGGGGGGGG - Intronic
915470896 1:156125217-156125239 AAGTAGGCTGAGGGGTAGGGAGG + Intronic
915701338 1:157799637-157799659 TTGTGGGGTGCGGGGGAGGAGGG + Intronic
915897907 1:159825652-159825674 TAGGATGGGGTGGGGGTGGGTGG - Intergenic
916719462 1:167473408-167473430 TAGTAGCCTGTGGGCGTGGGTGG - Intronic
916992659 1:170260996-170261018 TTGTGGGGTGGCGGGGAGGGGGG + Intergenic
917413108 1:174780714-174780736 TTGTGGGGTGGGGGGGTGGGGGG - Intronic
917536932 1:175881101-175881123 GATGATGGTGTGGGGGAGGGAGG + Intergenic
917620047 1:176786356-176786378 TAGTATGCTGTGAGGGTGGGGGG + Intronic
917824405 1:178801813-178801835 TAGAAGGGAGGGAGGGAGGGAGG + Intronic
918043567 1:180927717-180927739 TGGTAGGGGGTGGGGGCTGGTGG + Intronic
918356749 1:183711784-183711806 GAATGGGGTGTGGGGGCGGGCGG + Intronic
918444361 1:184602124-184602146 TAGCAGGGTGAGGGTGAGGATGG - Intronic
919019952 1:192092708-192092730 TTGTGGGGTGGGGGGGAGGGGGG - Intergenic
919020444 1:192098456-192098478 TTGTGGGGTGGGGGGGAGGGGGG - Intergenic
919062131 1:192646645-192646667 TTGTAGGGTGGGGGCGTGGGAGG - Intronic
919072920 1:192778496-192778518 GAGAAGGGTGGGAGGGAGGGAGG - Intergenic
919171480 1:193959577-193959599 TTGTAGGGTGAGGGGGCGGGGGG + Intergenic
919656668 1:200203480-200203502 TAGCTGGGTGTGGTGGTGGGTGG - Intergenic
919744513 1:201000185-201000207 TAGGAGAACGTGGGGGAGGGAGG + Intronic
920093873 1:203473134-203473156 CAGTAGGGTTTGTGGGAGTGGGG + Intergenic
920640269 1:207745071-207745093 TAGTTGGGGGTGGGGTGGGGTGG - Intergenic
921289334 1:213641807-213641829 TTGCAGGGGGTGGGGGTGGGTGG - Intergenic
921349943 1:214224797-214224819 GAGGAGGGTGAGGAGGAGGGAGG - Intergenic
921882577 1:220271913-220271935 TAGGAATGTGTGGGGGTGGGGGG + Intronic
922129462 1:222762570-222762592 TTGTGGGGTGGGGGGGAGGGGGG + Intergenic
922209969 1:223479166-223479188 TAGGAGGGTGAGGAGGTGGGGGG + Intergenic
922342624 1:224669949-224669971 CTGTTGGGTGTGGGGGTGGGGGG - Intronic
922351405 1:224737221-224737243 TGGGAGGGGGTGGGGTAGGGAGG + Intronic
922638750 1:227205111-227205133 TAGCCGGGTGTGGTGGTGGGAGG + Intronic
922755636 1:228095278-228095300 TGGTGGGGGGTGGGGGTGGGCGG + Intronic
922777570 1:228223170-228223192 AAGTAGGGTGTGGGGACAGGTGG + Intronic
922930451 1:229385215-229385237 CAGCAGGGTGAGGGTGAGGGTGG - Intergenic
923032687 1:230262704-230262726 TCTTGGGGTGTGGGGGTGGGAGG + Intronic
923519868 1:234726956-234726978 CCGTAGGGTGTGGGGGAAGGGGG + Intergenic
923782903 1:237042123-237042145 GGGTGGGGTGTGGGGGCGGGCGG - Intergenic
924294277 1:242569557-242569579 TAGCAGGGTGTGTGGAAGGCTGG - Intergenic
924308696 1:242718485-242718507 TAGTGGGGTGGGGGCGGGGGTGG - Intergenic
924359036 1:243216348-243216370 TTGTGGGGTCGGGGGGAGGGGGG - Intronic
924603580 1:245513132-245513154 GAGGAGGGTGTGGAGGAGGGTGG - Intronic
1062777860 10:169305-169327 GTGTAAGGTGTGGGGAAGGGAGG - Intronic
1062829921 10:598579-598601 TAGGAGGGGGTGGGGAGGGGTGG - Intronic
1063046776 10:2400211-2400233 TAGTTGGGTGAGGGTGAGGTAGG - Intergenic
1063201400 10:3787353-3787375 TATTACGGTGTGGGAGAGGTGGG + Intergenic
1063278552 10:4598611-4598633 TTGTGGGGTGGGGGGGAGGGGGG + Intergenic
1063425004 10:5943888-5943910 TAGTAAGGTGTTGGTGAGGCTGG - Intronic
1063517625 10:6712256-6712278 GAGGAGGGTGTGGGGAGGGGAGG + Intergenic
1063624466 10:7676254-7676276 GAATAGGGTGGGGGTGAGGGAGG + Intergenic
1063650544 10:7932466-7932488 AAGCAGGGTGTGAGAGAGGGAGG + Intronic
1063697961 10:8356293-8356315 TAGAAGGGAGGGAGGGAGGGAGG - Intergenic
1063927465 10:10994724-10994746 GGGTGGGGTGTGGGGGTGGGAGG - Intergenic
1064272689 10:13879748-13879770 AAGGAGGGGGAGGGGGAGGGGGG - Intronic
1064288543 10:14013329-14013351 GAGTGGCGTGTGGGAGAGGGTGG - Intronic
1064738269 10:18406211-18406233 CAATAGGTTGTGGGGAAGGGAGG + Intronic
1064794720 10:18998429-18998451 TATTGTGGGGTGGGGGAGGGGGG + Intergenic
1065216571 10:23455002-23455024 TCCTAGGGCGTGGGGGTGGGTGG - Intergenic
1065275725 10:24083767-24083789 TAGTGGGGAGAGGGAGAGGGAGG + Intronic
1065534005 10:26700248-26700270 AAGCGGGGTGGGGGGGAGGGGGG - Intronic
1065667668 10:28080058-28080080 TGGGAGGGGGAGGGGGAGGGAGG + Intronic
1065876912 10:30005175-30005197 TAGAAGGGAGGGGGGGAGTGAGG - Intergenic
1066021583 10:31309215-31309237 TTGTGTGGGGTGGGGGAGGGGGG - Intergenic
1066040733 10:31546101-31546123 TTCTAGGGTGTGGAGGATGGTGG + Intergenic
1066249279 10:33617224-33617246 AAGAAGGGGGTTGGGGAGGGAGG + Intergenic
1066277157 10:33880532-33880554 TTGTTGGGGGTGGGGGGGGGTGG - Intergenic
1066551840 10:36567554-36567576 TAGTGGGGTATGTGGGAGGAGGG - Intergenic
1066817194 10:39434793-39434815 TTGTGGGGTGAGGGGGTGGGAGG - Intergenic
1067206936 10:44226104-44226126 TATTAGGGTGTGGGGGGTGAGGG - Intergenic
1067234850 10:44438961-44438983 CTGTAGGCTCTGGGGGAGGGTGG + Intergenic
1067557709 10:47284237-47284259 TGGTTGGGTGGGGGGCAGGGGGG + Intergenic
1068520581 10:58073113-58073135 TAGGAGGGAGGGTGGGAGGGGGG - Intergenic
1069370769 10:67745506-67745528 TTGTGGGGTGGGGGGGAGGGGGG + Intergenic
1069388918 10:67911775-67911797 TAGGAGGGAGGGAGGGAGGGTGG - Intronic
1069658043 10:70104967-70104989 TGGCAGGGGGTCGGGGAGGGTGG + Intronic
1069679512 10:70274001-70274023 TGGGATGGTGTTGGGGAGGGAGG - Intronic
1069815554 10:71191593-71191615 CAGGAGGGTGAGGGGCAGGGGGG + Intergenic
1069850077 10:71398514-71398536 TTGTGGGGTGTGGGGTGGGGCGG + Intronic
1070107435 10:73448137-73448159 CAGTAGGGTGTTGGGGAGGATGG + Intronic
1070444189 10:76478894-76478916 TTGTGGGGTGTGGGGGAGGGGGG + Intronic
1070566071 10:77604879-77604901 AAGGAAGGGGTGGGGGAGGGTGG - Intronic
1071361674 10:84852252-84852274 AAGAAGGGTGGTGGGGAGGGTGG - Intergenic
1071430368 10:85602229-85602251 TGGTCGGGTGGGTGGGAGGGTGG + Exonic
1071518794 10:86316307-86316329 TGTGAGGGTGTGTGGGAGGGTGG - Intronic
1071667790 10:87577260-87577282 TAGTCGGGGGTGGGGGGTGGGGG + Intergenic
1072250886 10:93581540-93581562 CAGAAGGGTGTGAGGTAGGGTGG + Intronic
1072452685 10:95551356-95551378 TACCTGGGTGTGGGGTAGGGTGG - Intronic
1072592104 10:96835778-96835800 TTGGAGGGTGTGGGGGCAGGTGG + Intronic
1072844629 10:98816024-98816046 TTGTGGGGTGGGGGGGAGGGGGG + Intronic
1072909674 10:99488576-99488598 TTGTATCCTGTGGGGGAGGGAGG + Intergenic
1073428525 10:103471187-103471209 TGATAGGGTGTGGAGGAAGGAGG - Intergenic
1073563067 10:104513398-104513420 TGGTGTGGTGTGGGGGTGGGCGG + Intergenic
1073578445 10:104643042-104643064 TAGTAGGGACCGCGGGAGGGAGG - Intronic
1073595279 10:104793443-104793465 TGGTAGGATGTTGGGGAGGGTGG + Intronic
1073596686 10:104807586-104807608 TCTCAGGTTGTGGGGGAGGGTGG + Intronic
1073599388 10:104831840-104831862 AAGTAGGTGATGGGGGAGGGGGG + Intronic
1073850584 10:107612669-107612691 CAGGAGGGTTTGGGGGAGGGAGG + Intergenic
1074043181 10:109812570-109812592 TGGTGGGGTCGGGGGGAGGGGGG - Intergenic
1074086827 10:110214618-110214640 GAGGAGGGGGTGGGGTAGGGAGG - Intronic
1074241417 10:111643075-111643097 TCGTGGGGTGGGGGGGAGGAGGG + Intergenic
1074444877 10:113513439-113513461 GAGAAGGAAGTGGGGGAGGGAGG - Intergenic
1074853349 10:117456015-117456037 CAGGAGGGGGTGGGGAAGGGAGG + Intergenic
1075015643 10:118908445-118908467 CAGTGGGGGCTGGGGGAGGGAGG - Intergenic
1075561444 10:123471531-123471553 TGGAAGGGTGGGAGGGAGGGAGG - Intergenic
1075857332 10:125640946-125640968 GAGATGGGTGTGGGGGAGGAAGG - Intronic
1076138986 10:128064679-128064701 TAGGAGGTTGTGGGGGAAGATGG - Intronic
1076359446 10:129876888-129876910 TAGCTGGGTGGGGGGGGGGGGGG - Intronic
1076626495 10:131824404-131824426 CAGTAGGGAGAAGGGGAGGGAGG - Intergenic
1076646062 10:131955571-131955593 AACTGGGTTGTGGGGGAGGGTGG + Intronic
1076804738 10:132849739-132849761 CTGTAGGGGGTGGGGGATGGAGG + Intronic
1077132246 11:978888-978910 GAGTTGGGTGGTGGGGAGGGAGG + Intronic
1077314040 11:1908314-1908336 TATTTGGGGGTGGGGGTGGGCGG - Intergenic
1077321048 11:1942115-1942137 TGGGAGGGAGTGGGGGAGGAAGG + Intergenic
1077428774 11:2503536-2503558 TTGTGGGGTTGGGGGGAGGGGGG + Intronic
1077452920 11:2661799-2661821 TAGTTGGGTGTTGGGGTGGGTGG - Intronic
1077696813 11:4400964-4400986 TTGTGGGGTGGGGGGGAGGGGGG - Intergenic
1077819421 11:5721944-5721966 TTGTGGGGTGGGGGGAAGGGGGG - Intronic
1077830231 11:5860212-5860234 AGGTAGGGTGTGGTGGAGGTTGG - Intronic
1078128410 11:8591832-8591854 TTGTGGGGTGGGGGGGAGTGGGG + Intronic
1078369288 11:10731708-10731730 GAGTAGGGTGTCGGGAAGTGGGG - Intergenic
1078489646 11:11757247-11757269 TGGTAGTGTGGGGGGGGGGGGGG - Intergenic
1079157288 11:17959971-17959993 AAGGAGTGTGTGGGGAAGGGAGG - Intronic
1079186126 11:18238800-18238822 TAGTGGGGAGGGGGGGAGTGAGG - Intergenic
1079241659 11:18726289-18726311 TTGTGGGGGGAGGGGGAGGGCGG + Intergenic
1079313970 11:19391664-19391686 TAGTCTGGTGTGGGGCAGTGGGG + Intronic
1079495906 11:21043797-21043819 TAGTAGGGTAAAGGAGAGGGAGG + Intronic
1079628190 11:22641489-22641511 TCGTGGGGTGTGTGGGGGGGAGG - Intronic
1080107832 11:28529598-28529620 TAGCAGGGGGTGGGGGGCGGGGG + Intergenic
1080165097 11:29226323-29226345 TAGTAGTGACTGGGGGTGGGGGG + Intergenic
1080389846 11:31834790-31834812 AAGTAGGGAGGGAGGGAGGGAGG - Intronic
1081016687 11:37891219-37891241 TTCTAGGGTGTGGAGGATGGTGG + Intergenic
1081059461 11:38455498-38455520 TGGGTGGGGGTGGGGGAGGGAGG - Intergenic
1081113405 11:39165876-39165898 TAGCTGGGCGTGGTGGAGGGTGG + Intergenic
1081428008 11:42946174-42946196 TTGTGGGGTGGGGGGGAGGGAGG + Intergenic
1081794983 11:45812770-45812792 CAGGAGGGTGTGGTGAAGGGTGG - Exonic
1081810215 11:45910219-45910241 AAGGAGGGTGTGGGGAGGGGTGG - Intronic
1082079405 11:48000575-48000597 TCGGAGGGTGGAGGGGAGGGAGG - Intronic
1082135264 11:48542130-48542152 TTGTGGGGTGGGGGTGAGGGGGG - Intergenic
1082138799 11:48581781-48581803 TTGTGGGGTGGGGGGGGGGGAGG + Intergenic
1082596707 11:55090367-55090389 TTGTGGGGTGGGGGGAAGGGGGG + Intergenic
1083387113 11:62319538-62319560 TAGTAGGGGGTGGTGGTGGGAGG - Intergenic
1083411955 11:62499996-62500018 TAGTCTGGTGTGGGGGACAGAGG - Intronic
1083550940 11:63589884-63589906 TAGTCGGGGGCGGGGGTGGGTGG - Intronic
1083727477 11:64636100-64636122 GAGGTGGGGGTGGGGGAGGGGGG + Intronic
1083890509 11:65593438-65593460 TAACAGCGTGTGGGGGAAGGGGG - Intronic
1083945325 11:65919877-65919899 TCGAGGGGCGTGGGGGAGGGAGG + Intronic
1084043334 11:66555262-66555284 TAGAAGGGTGTAAGGGAGGAGGG - Intronic
1084072747 11:66746728-66746750 TAGCAGGGTGTGGTGGCAGGCGG + Intronic
1084336432 11:68460622-68460644 TAGTAGGGGGCGGGAGAGAGGGG + Intergenic
1084590411 11:70086802-70086824 GAGTAGGGTGAAGGGGAGGGAGG - Intronic
1084904472 11:72335122-72335144 AAGTAGTGTGGGGGGGTGGGTGG + Intronic
1085393599 11:76194914-76194936 CAGCAGGGTGTGGGCGAAGGTGG - Intronic
1085528564 11:77178249-77178271 TAGGTGGGTGTGTGGGCGGGTGG - Intronic
1086559120 11:88146868-88146890 TTGTACGGTGTTGGGGAAGGGGG - Intronic
1086847687 11:91772639-91772661 AAGTGGGGTGGGGGGGAGGGTGG - Intergenic
1087372630 11:97303953-97303975 TCGTAGGGTGGGGGGAAGGGGGG + Intergenic
1087410759 11:97787694-97787716 TGGAAGGGTGGAGGGGAGGGAGG - Intergenic
1087794886 11:102445016-102445038 TCGTGGGGTGGGGGGAAGGGGGG + Intronic
1087888681 11:103511447-103511469 TTGTGGGGTTGGGGGGAGGGGGG - Intergenic
1088701111 11:112412551-112412573 TAGTAGGGAGTGTGGGGGTGTGG + Intergenic
1088757351 11:112896942-112896964 TTGTGGGGTGGGGGGGAGGAGGG - Intergenic
1089013456 11:115148280-115148302 GTGTAGTGTGTGTGGGAGGGTGG + Intergenic
1089040898 11:115448661-115448683 TAGGAGGGGGTGGGGTGGGGTGG + Intronic
1089041253 11:115452153-115452175 TGGTGGGGTGGGGGGGTGGGGGG + Intronic
1089540504 11:119186781-119186803 TCCTGGGGTGTGGGGGAGTGAGG - Intronic
1089619247 11:119713121-119713143 AAGCAGCCTGTGGGGGAGGGTGG + Intronic
1089775386 11:120832042-120832064 CAGCAGGGGGTGGGGGAGAGAGG - Intronic
1089781461 11:120875902-120875924 TATTAGGGTGATGGCGAGGGTGG - Intronic
1089895824 11:121929180-121929202 TAAAAGGGAGTGGGGGAGGGTGG - Intergenic
1089946382 11:122478386-122478408 TGGTGGGGTCGGGGGGAGGGGGG + Intergenic
1090022205 11:123137995-123138017 TTTTATGGTTTGGGGGAGGGAGG - Intronic
1090038988 11:123273871-123273893 GAGGAGAGTTTGGGGGAGGGAGG - Intergenic
1090357069 11:126147232-126147254 CAGTAGGGAGGGAGGGAGGGAGG - Intergenic
1090668280 11:128929659-128929681 TGGGAGAGTGTGGGGGAGGGGGG - Intergenic
1090683896 11:129094089-129094111 TAGTGGGGTGGGGAGGAGGTGGG + Intronic
1090738856 11:129638131-129638153 AAGTAGGGTGTGGGGTGGGGAGG - Intergenic
1090894400 11:130957322-130957344 TTGTGGGGTGGGGGTGAGGGGGG + Intergenic
1091073983 11:132596981-132597003 GAGTAGGTTGGGGGTGAGGGTGG - Intronic
1091084911 11:132712298-132712320 GAGGAGGATGTGGGGGAGGGTGG - Intronic
1091150821 11:133326707-133326729 TAGTGGGGTGTGGGTGTAGGGGG + Intronic
1091689210 12:2584318-2584340 TAGGAGGGTGATGGGGAGGAAGG + Intronic
1091764128 12:3107182-3107204 CCGTGGGGAGTGGGGGAGGGAGG + Intronic
1091824320 12:3499341-3499363 TGGTGGGGTCGGGGGGAGGGGGG - Intronic
1092026978 12:5249038-5249060 AGGTGGGTTGTGGGGGAGGGTGG + Intergenic
1092045815 12:5431421-5431443 TAGAGGGGCGTGGGGGCGGGTGG - Intergenic
1092051632 12:5474940-5474962 GAGCAGGGTTTGGGGGAGGATGG + Intronic
1092139219 12:6171368-6171390 TAATGGGGGGGGGGGGAGGGGGG + Intergenic
1092732142 12:11544910-11544932 TTTTATGGTGTGGGGGTGGGTGG - Intergenic
1092733821 12:11559962-11559984 TAGTTGAGTGTGGGAGAAGGTGG + Intergenic
1092903018 12:13077415-13077437 TTGTGGGGTGGGGGGGAGGGGGG - Intronic
1092964283 12:13626806-13626828 GGGGAGGGTGGGGGGGAGGGGGG - Intronic
1092972786 12:13714142-13714164 GAGTGGTGGGTGGGGGAGGGAGG - Intronic
1093081913 12:14822018-14822040 GAGTAGGGGATGGGGGTGGGTGG + Intronic
1093527483 12:20118719-20118741 CAGTAGGATATGGGGGAGGCAGG + Intergenic
1093777129 12:23089095-23089117 TTGTGGGGTGGGGGGGAGGATGG - Intergenic
1093956694 12:25228594-25228616 TACCAGGGGCTGGGGGAGGGAGG + Intronic
1094004011 12:25727594-25727616 TAGCTGGGTGTGGTGGTGGGAGG + Intergenic
1094608173 12:31967614-31967636 TTGTGGGGGGTGGGGGTGGGCGG - Intronic
1094840545 12:34341030-34341052 TGGCAGGGTGTGCGTGAGGGGGG - Intergenic
1095101241 12:38186157-38186179 TTGTGGGCTGGGGGGGAGGGGGG + Intergenic
1095137463 12:38622927-38622949 TTGTGGGGTGGGGGGGAGGGAGG + Intergenic
1095945071 12:47749106-47749128 GACTAGGCTGTGGGGGAGGCAGG - Intronic
1096123817 12:49105570-49105592 GAGCAGGGTGTGGGGAAGGTGGG - Intronic
1096379765 12:51146368-51146390 GGGTATGGGGTGGGGGAGGGAGG - Intronic
1096460254 12:51818370-51818392 TATTGGGGGGTGGGGGTGGGTGG - Intergenic
1096595018 12:52689493-52689515 GAGTAGGGGGAGGAGGAGGGAGG + Intergenic
1097534863 12:60855924-60855946 TTGTGGGGTGGGGGGGAGGGGGG - Intergenic
1097588105 12:61539692-61539714 TTGTGGGGTGTGGGGGGAGGGGG - Intergenic
1097620415 12:61932586-61932608 TAGCTGGGCGTGGTGGAGGGGGG - Intronic
1097751181 12:63354577-63354599 TTGTGGGGTGGGGGGGAGGGGGG + Intergenic
1097768989 12:63558441-63558463 TGGTGGGGGGTGGGGGTGGGGGG - Intergenic
1097863918 12:64543489-64543511 GGGGAGGGTGTGGGGGAGTGGGG - Intergenic
1097960706 12:65529490-65529512 TTATAGGGTGTTGGGGATGGAGG + Intergenic
1098142469 12:67464397-67464419 TAGGGGGTTGTGGGGGAGGTGGG - Intergenic
1098442361 12:70532330-70532352 TAGAAGGCTGTGGGGGGGTGGGG - Intronic
1098866043 12:75764834-75764856 TAGTGGTGTTTTGGGGAGGGAGG + Intergenic
1098916840 12:76266255-76266277 TAGAAGGCTGTGGTGGTGGGGGG - Intergenic
1098939735 12:76520032-76520054 TAGGAGGGTTTGTGGGAGGTAGG - Intronic
1098979441 12:76939074-76939096 GAGTAGGGAGTGGGGAATGGTGG + Intergenic
1099082587 12:78204201-78204223 TTGTGGGGTGGGGCGGAGGGGGG + Intronic
1099109993 12:78546842-78546864 TCGTAGGGTGGGGGTTAGGGTGG + Intergenic
1099436502 12:82652575-82652597 CTGTGGGGTGGGGGGGAGGGGGG - Intergenic
1099686289 12:85893502-85893524 TAGTGGGGTTGGGGTGAGGGAGG - Intergenic
1099715329 12:86286734-86286756 TACAAGGGGGTGGGGGTGGGAGG - Intronic
1100344178 12:93711025-93711047 TGGGAGGGTGGGGTGGAGGGGGG - Intronic
1101003889 12:100383004-100383026 TTGTGGGGTGTGGGGGATAGAGG + Intronic
1101461026 12:104893866-104893888 TAGGAGGGTATGGGGGAGGTAGG + Intronic
1101799140 12:108005482-108005504 TGGGAGAGTTTGGGGGAGGGTGG - Intergenic
1101922148 12:108941808-108941830 TAGCTGGGTGTGGTTGAGGGGGG - Intronic
1102268110 12:111506633-111506655 AAGGAGGGGGAGGGGGAGGGGGG - Intronic
1102394422 12:112574760-112574782 GAGAAGGGTGTGGTGGAGGAGGG + Intronic
1102716067 12:114973836-114973858 TTGTTGGGGGTGGGGGTGGGGGG + Intergenic
1102985899 12:117278125-117278147 TTGTAGGGTGTGGGGTACAGTGG - Intronic
1103119278 12:118367747-118367769 TAGAAGGGAGAGAGGGAGGGAGG - Intronic
1103215500 12:119198557-119198579 AAGCAGGGTTTGGGGCAGGGAGG + Intronic
1103260978 12:119588363-119588385 GGGCAGGGGGTGGGGGAGGGAGG - Intergenic
1103294109 12:119871496-119871518 CATTTGGTTGTGGGGGAGGGGGG - Intronic
1103521488 12:121538980-121539002 GAGAAGGGTGTGGGACAGGGTGG - Intronic
1103832716 12:123793114-123793136 TAGAATGGAGTGGGGGTGGGAGG + Intronic
1103937845 12:124485971-124485993 TGGTAGGGTGAGAGGGAGGTGGG - Intronic
1103946514 12:124530279-124530301 TAGTCGGGGGTGGGGGGTGGAGG + Intronic
1103948392 12:124539451-124539473 TGGGAGGGTGAGGGGGAGCGTGG - Intronic
1103967119 12:124646943-124646965 TAGAAGAGTTGGGGGGAGGGGGG - Intergenic
1104671166 12:130681488-130681510 TACTAGGGAATAGGGGAGGGAGG - Intronic
1104805775 12:131588319-131588341 GAGTAGGGTGGGGTGGAGTGGGG + Intergenic
1105449001 13:20482022-20482044 GAGATGGGTGTGGGGGTGGGGGG - Intronic
1105570976 13:21603088-21603110 TAGCTGGGTGTGGTGGCGGGAGG - Intronic
1105673121 13:22642411-22642433 ATGGAGGGTGTGGGGGAGGTGGG + Intergenic
1105818306 13:24057226-24057248 TTGTGGGGTTGGGGGGAGGGGGG - Intronic
1106218596 13:27725320-27725342 ATGTAGGGTGTGGGTGGGGGTGG + Intergenic
1106310057 13:28546239-28546261 TAGTAGAGTGGGAGGGAGTGAGG - Intergenic
1106737429 13:32602241-32602263 TAGTGGGGTGAGGGGAAGGGAGG - Intronic
1107440740 13:40425384-40425406 GAGCAGGGTGAGGTGGAGGGTGG - Intergenic
1107461472 13:40607518-40607540 TAGATGGGTGGGAGGGAGGGAGG + Intronic
1107514533 13:41116119-41116141 TACTTTGGTGTGGGGGGGGGGGG + Intergenic
1107686200 13:42901911-42901933 TTGTGGGGTGGGGGGAAGGGGGG - Intronic
1108146579 13:47483694-47483716 TGGCAGGGTGTGGGGGAAGCAGG + Intergenic
1108494497 13:51010640-51010662 TAGTCGGGTGTGGTGGCGGGGGG - Intergenic
1108760930 13:53563705-53563727 TTGTGGGGTGGGGGGAAGGGGGG - Intergenic
1109003808 13:56842693-56842715 TTGTGGGGTGGGGGGAAGGGGGG - Intergenic
1109587276 13:64423040-64423062 TTGTGTGGTGGGGGGGAGGGGGG - Intergenic
1109833618 13:67826371-67826393 CCGTGGGGTGGGGGGGAGGGGGG + Intergenic
1109882012 13:68490930-68490952 TAGAAGGATGTGTGGGTGGGAGG + Intergenic
1110067332 13:71125077-71125099 TAGCAGGGTGTGGTGGTGGGTGG + Intergenic
1110499890 13:76214890-76214912 TTGTGGGGTGGGGGGGAGGAGGG - Intergenic
1110667742 13:78137711-78137733 TAGTAGTGGGTGGGGAAGAGGGG - Intergenic
1110789746 13:79574673-79574695 TTGTGGGGTGGGGGGGAGGGGGG + Intergenic
1110795083 13:79627465-79627487 TACTAGGGGGTTGGGGAGTGGGG + Intergenic
1110879379 13:80552594-80552616 AAGGAGGGTGGGAGGGAGGGAGG + Intergenic
1110924374 13:81131859-81131881 TTCTAGGGTCTGGAGGAGGGTGG - Intergenic
1111512764 13:89287694-89287716 TTGTTGGGGGTGGGGTAGGGGGG + Intergenic
1111735485 13:92133616-92133638 TAGAAGGGAGAGAGGGAGGGAGG - Intronic
1111812429 13:93107734-93107756 TTGTGGGGTGGGGGGGAGGGGGG - Intergenic
1112060477 13:95734964-95734986 TTGTGGGGTGGGGGGGAGGGGGG - Intronic
1112075077 13:95904439-95904461 TTGTGGGGTGGGGGGGAGGGGGG - Intronic
1112107723 13:96260278-96260300 AAGTAGGGAGGGAGGGAGGGAGG - Intronic
1112116780 13:96364590-96364612 TACAAGGGTCTGGGGGAGGGAGG + Intronic
1112210082 13:97367719-97367741 GAGCAGAGAGTGGGGGAGGGAGG + Intronic
1112573361 13:100613813-100613835 TAGGGGGGAGAGGGGGAGGGAGG - Intronic
1112699450 13:101988703-101988725 TTGTGGGGTGGGGGGGAGGGGGG + Intronic
1113165404 13:107435079-107435101 TAGTAAGATTTGGGGGTGGGGGG + Intronic
1113203477 13:107891709-107891731 TGGTGGGGTGGGGGGGAGGGGGG + Intergenic
1113894806 13:113757068-113757090 AAGTATAGTGTGGGAGAGGGAGG - Intergenic
1114275840 14:21143363-21143385 TCGTAGTGGGTGGGGGAGGTGGG - Intergenic
1114408987 14:22483076-22483098 TTGAAGGGAGTGGGGGAAGGGGG + Intergenic
1114490019 14:23094696-23094718 AAGGAGGGGGTGGGGGAAGGAGG + Intronic
1114666098 14:24377910-24377932 AAGGAGTGTGTGGAGGAGGGAGG + Exonic
1114761103 14:25315572-25315594 TAGTAGAGGGTGGGAGAGAGTGG - Intergenic
1114800590 14:25771462-25771484 TTGTGGGGTGGGGGGAAGGGGGG - Intergenic
1115258240 14:31425494-31425516 TAGCTGGGTGTGGTGGTGGGAGG + Intronic
1115454031 14:33580786-33580808 TAGGGGGGTGCGGTGGAGGGTGG - Intronic
1115955083 14:38768682-38768704 TTGTGGGGTTGGGGGGAGGGGGG + Intergenic
1116281370 14:42913414-42913436 TTAGAGGGTGTGGGGGAGTGAGG - Intergenic
1116422800 14:44752337-44752359 TAGCCGGGTGTGGTGGCGGGGGG + Intergenic
1116618042 14:47163407-47163429 TGGTGGGTTGTGGGGGTGGGGGG + Intronic
1116771465 14:49131621-49131643 TGGTGGGGTGGGGGGGGGGGTGG - Intergenic
1116985373 14:51213766-51213788 TTGTAGGGTGGAGGGGAGGGGGG - Intergenic
1117875289 14:60245756-60245778 TATTATGATGTAGGGGAGGGAGG + Exonic
1117881872 14:60320337-60320359 TTGTGGGGTCTGGAGGAGGGTGG - Intergenic
1117898175 14:60508888-60508910 TAGAGCGGGGTGGGGGAGGGAGG + Intronic
1118542579 14:66844882-66844904 TACCAGGGGTTGGGGGAGGGAGG - Intronic
1118594590 14:67425875-67425897 ATGTGGGGTGTGGGGCAGGGAGG - Intergenic
1118640398 14:67787047-67787069 TAGTAAGGGGTGGGGGAAGATGG + Intronic
1119231476 14:72983342-72983364 TGGTGGGGTGGGGGGGAGGGGGG - Intronic
1119464417 14:74843740-74843762 CAGTAGGGTATGGTGGAGGCTGG + Intronic
1119857893 14:77914533-77914555 GAGCAGAGTGTGGGAGAGGGTGG + Intronic
1119887080 14:78152154-78152176 TTGTGGGGTGTGTGGGTGGGAGG + Intergenic
1119900346 14:78254305-78254327 TAGTTGGGTATGGGGGAAGATGG - Intronic
1120542881 14:85772376-85772398 TTGTGGGGTGGGGGGGCGGGGGG - Intergenic
1120620734 14:86761324-86761346 TAGTAGGGTGTGGTGGCATGCGG - Intergenic
1120756020 14:88245326-88245348 ATGCATGGTGTGGGGGAGGGAGG - Intronic
1120812409 14:88817641-88817663 TAGCCAGGTGTGGTGGAGGGCGG - Intergenic
1120871375 14:89339949-89339971 TAGGAGGGTTTGGGGGTGGGGGG + Intronic
1121390391 14:93568526-93568548 TAGCTGGGTGTGGTGGCGGGTGG + Intronic
1121518325 14:94568707-94568729 TAGAATGGTGTGGTGGCGGGTGG + Intronic
1121606402 14:95243538-95243560 TAGTAGGGGTTAGGTGAGGGAGG - Intronic
1121800281 14:96768968-96768990 AAGGAGGGAGTGAGGGAGGGAGG - Intergenic
1121800291 14:96769007-96769029 AAGGAGGGAGTGAGGGAGGGAGG - Intergenic
1121800301 14:96769046-96769068 AAGGAGGGAGTGAGGGAGGGAGG - Intergenic
1122203952 14:100138998-100139020 GAAGAGGGTGTGGGGGAGCGCGG + Intronic
1122226120 14:100281107-100281129 TAGTCGGGGGTGGGGGGAGGTGG - Exonic
1122323263 14:100867945-100867967 GACTAGGGGGTGGGGGTGGGGGG - Intergenic
1122447853 14:101782103-101782125 AAGAAGGGGGAGGGGGAGGGGGG - Intronic
1122923586 14:104889995-104890017 TAGGAGGGTGGGTGGGTGGGTGG + Intronic
1123207966 14:106731979-106732001 TTGTGGGGGTTGGGGGAGGGGGG - Intergenic
1123782375 15:23641395-23641417 TAGCCGGGTGTGGTGGCGGGCGG - Intergenic
1124505545 15:30269965-30269987 TATTTGGAGGTGGGGGAGGGGGG + Intergenic
1125490099 15:40140828-40140850 TTGTCGGGTGGGGGGGAGCGGGG + Intergenic
1125528460 15:40394941-40394963 TAGCTGGGTGTGGTGGTGGGGGG - Intergenic
1125709687 15:41774717-41774739 GGATAGGGAGTGGGGGAGGGAGG + Intronic
1126026686 15:44453569-44453591 TCGTGGGGTGGGGGGGATGGGGG - Intronic
1126070049 15:44858298-44858320 TTGTGGGGTTGGGGGGAGGGGGG + Intergenic
1126183400 15:45808136-45808158 TATTAAGTTGTCGGGGAGGGAGG - Intergenic
1126357507 15:47812027-47812049 GGGTATGGTGTGGGGGCGGGGGG - Intergenic
1126940497 15:53760312-53760334 TAGTGGGGGGTGGGGGAGTCGGG - Intronic
1127012876 15:54649462-54649484 TTGTAGAGTCTGGGGGATGGTGG + Intergenic
1127117712 15:55743575-55743597 TAGGAGGGTGTAGGAGGGGGTGG - Intergenic
1127178741 15:56391545-56391567 TAGTAGGATGTGGTGGAGGGAGG + Intronic
1127385282 15:58461922-58461944 GAGTGGGATGTGGGGGCGGGGGG - Intronic
1127609632 15:60624023-60624045 GAGTAGGGGGTGGGAAAGGGTGG + Intronic
1127661596 15:61104628-61104650 GAGTAGAGAGTGGGGGAGAGTGG - Intronic
1127708529 15:61571493-61571515 TGCTAGGGGGTTGGGGAGGGTGG - Intergenic
1128420941 15:67491199-67491221 TAGTAGGGTGTAGGGGAGGTTGG - Intronic
1128620107 15:69141658-69141680 TGGCAGGGTGGGGGGGTGGGGGG - Intergenic
1128868791 15:71136663-71136685 TAGGAGGGAGGGAGGGAGGGAGG + Intronic
1128990298 15:72254121-72254143 TGGGAGGGTGAGGAGGAGGGGGG - Intronic
1129020542 15:72513782-72513804 AAGGAGGGAGAGGGGGAGGGAGG - Intronic
1129145888 15:73646814-73646836 GAGGAGGGGGAGGGGGAGGGGGG + Intergenic
1129393598 15:75232735-75232757 TGGTAGGGTGGGTGGGAGGCTGG + Intergenic
1129540784 15:76345984-76346006 TGTTAGGGCGTGGGGGAGGGAGG + Intergenic
1129606476 15:77027700-77027722 CAGCAGGCTCTGGGGGAGGGAGG + Intronic
1129615111 15:77092605-77092627 AATTAGGGGGCGGGGGAGGGTGG - Intergenic
1129717821 15:77862321-77862343 GTGTGGAGTGTGGGGGAGGGAGG + Intergenic
1129872507 15:78949665-78949687 TTGTGGGGGGTGGGGGAGGGGGG - Intergenic
1129894321 15:79092218-79092240 TGGTGGGGTGTGGGGGGGTGTGG - Intergenic
1130055086 15:80516013-80516035 TAGCTGGGTGTGGTGGTGGGAGG - Intronic
1130264694 15:82389811-82389833 TTGTGGGGTGGGGGGGAGGGGGG - Intergenic
1130303529 15:82698361-82698383 TAAGAGGGTGTGGGAGAGTGGGG - Intronic
1130303542 15:82698437-82698459 TATGAGGGTGTGGGGGAGCGGGG - Intronic
1130575612 15:85090690-85090712 TAGATGGGGGTGGGGGTGGGGGG - Intronic
1130603941 15:85298136-85298158 TAGCTGGGTGTGGTGGGGGGTGG - Intergenic
1130619539 15:85447516-85447538 TATTTGGGGGTGGGGGAGGAGGG - Intronic
1130858054 15:87858943-87858965 TAGTAGGGTGGGGGTGGAGGAGG + Intergenic
1130908143 15:88254172-88254194 TAGTAGGGTGCTGGTGAAGGTGG - Intronic
1131083461 15:89555934-89555956 CTGCAGGGTGTGGGGCAGGGAGG + Intergenic
1131095692 15:89653053-89653075 TTGGAGGGATTGGGGGAGGGTGG + Intronic
1131547970 15:93331833-93331855 CACTTGGCTGTGGGGGAGGGGGG + Intergenic
1131814299 15:96206419-96206441 TTGTGGAGTGGGGGGGAGGGGGG + Intergenic
1131904583 15:97129091-97129113 TAGCCGGGTGTGGTGGCGGGAGG + Intergenic
1132260773 15:100422932-100422954 TTGTGGGGTGGGGGGGAGGGGGG + Intronic
1132386099 15:101401013-101401035 TAGTTGGTGGTGGGAGAGGGAGG + Intronic
1132912564 16:2322524-2322546 TTGTGGGGTGGGGGGGCGGGGGG - Intronic
1133003353 16:2862805-2862827 TGGGAGGGTGGGAGGGAGGGAGG + Intergenic
1133057196 16:3151311-3151333 TAGTAGGGTGGGGGGGTGGGCGG + Intergenic
1133069498 16:3235778-3235800 GAGTAGGGGGTGGGGGGGTGGGG - Intronic
1133196579 16:4175087-4175109 GAGTAGGGTGGGGAGGAGGCAGG + Intergenic
1133398755 16:5469309-5469331 TAGTTGGGTGTTTGGGAGGTGGG + Intergenic
1133454527 16:5930771-5930793 TGGTTGGGTGGGTGGGAGGGCGG + Intergenic
1133454577 16:5930939-5930961 TAGGTGGGTGGGTGGGAGGGTGG + Intergenic
1133470131 16:6066956-6066978 GAGTAGGGGGCGGGGGAGGGCGG + Intronic
1133558110 16:6924826-6924848 GGGTAGGGGGAGGGGGAGGGGGG - Intronic
1133912571 16:10079187-10079209 TAGTAGGGACTGGAGGAGAGGGG + Intronic
1134058245 16:11183332-11183354 CAGTAGGACGTGGGGGAAGGGGG - Intergenic
1134083542 16:11340912-11340934 GATTGTGGTGTGGGGGAGGGGGG + Intronic
1134162179 16:11900427-11900449 GTGTAGGGAGTGGGGGATGGAGG + Intronic
1134164548 16:11919708-11919730 TACCAGGGGGTTGGGGAGGGGGG - Intergenic
1134540063 16:15056602-15056624 GACGAGGGTATGGGGGAGGGTGG - Intronic
1134578799 16:15354322-15354344 GAGTAGTGAGTGGGGGCGGGGGG + Intergenic
1134723788 16:16403225-16403247 GAGTAGTGAGTGGGGGCGGGGGG - Intergenic
1134780165 16:16888182-16888204 TAGTGGAGTGTGGGGTAGAGAGG + Intergenic
1134943641 16:18308645-18308667 GAGTAGTGAGTGGGGGCGGGGGG + Intergenic
1135275379 16:21108017-21108039 TAGCCGGGTGTGGTGGTGGGTGG - Intronic
1135330578 16:21556696-21556718 TAGCAGAGTCTGGGGGATGGGGG - Intergenic
1135608957 16:23848111-23848133 GAAGAGGGTGTGAGGGAGGGAGG + Intronic
1135924917 16:26685199-26685221 TTGTAGGGTGGGGGGGGGGGGGG - Intergenic
1136058426 16:27707889-27707911 AATGAGGCTGTGGGGGAGGGGGG - Intronic
1136225467 16:28857395-28857417 TAATGGGGAGTGGGGGCGGGGGG + Intronic
1136278104 16:29191506-29191528 TGGGAGGGGGTGGCGGAGGGTGG - Intergenic
1136496240 16:30646577-30646599 TGGTGGGGTGGGGGGGAGGTGGG + Intergenic
1137044185 16:35641050-35641072 AAGCAGGGTGTGGGGCAGGTGGG + Intergenic
1137064444 16:35825498-35825520 TTGTGGGGTGTGGGGGAGAGGGG - Intergenic
1137374563 16:47941613-47941635 GAGTAGGGGGAGGGGGAGTGAGG + Intergenic
1137475261 16:48802414-48802436 GGGTAAGGTGTCGGGGAGGGAGG - Intergenic
1137666796 16:50254805-50254827 TGGCAGGGGGTGGGGGTGGGGGG - Intronic
1137817361 16:51411263-51411285 GAGTAGGGTGTGTGGGATGGAGG - Intergenic
1138800282 16:60018135-60018157 TAGAAAGGTGAGGGGGAGGAAGG - Intergenic
1139173652 16:64662286-64662308 AAGTAGGGAGGGAGGGAGGGAGG - Intergenic
1139437511 16:66944883-66944905 CAGTGGGGTGTTGGGGAGGGTGG - Exonic
1139613684 16:68076280-68076302 TAGTAGGGAGTGGGTGGAGGTGG - Intronic
1139992944 16:70954492-70954514 GGGTTGGGTTTGGGGGAGGGGGG - Intronic
1139996504 16:70985952-70985974 TTGTGGGGTCGGGGGGAGGGGGG + Intronic
1140087410 16:71809212-71809234 TAGGGGGGTGGGGGGTAGGGGGG + Intergenic
1140279764 16:73543830-73543852 GAGAAGGGGGTGGGGGAGGGAGG + Intergenic
1140349930 16:74252482-74252504 TCCCAGGGTGTGGGGGAGTGCGG + Intergenic
1140391018 16:74586839-74586861 TAGCAGGGTGTGGTGGTGGGAGG - Intronic
1140703182 16:77601582-77601604 GAGGAGTTTGTGGGGGAGGGGGG - Intergenic
1140814146 16:78604981-78605003 AAGGAGGGAGTGAGGGAGGGAGG - Intronic
1140880056 16:79189918-79189940 TGGTATGGGGTGGGGAAGGGGGG + Intronic
1141010065 16:80388874-80388896 AAGAGGGGTGTGTGGGAGGGAGG - Intergenic
1141128023 16:81415104-81415126 TACTTGGGTCGGGGGGAGGGAGG + Intergenic
1141137220 16:81474289-81474311 CAGTAGGGAGAGAGGGAGGGAGG - Intronic
1141172108 16:81697997-81698019 TTGTAGGGTGGGGGCGGGGGCGG - Intronic
1141178285 16:81734903-81734925 TGGTGGGGTGGGGGAGAGGGAGG + Intergenic
1141844764 16:86600243-86600265 TAGGAGAGTGTGGGGAAGAGAGG + Intergenic
1141857197 16:86691464-86691486 AAGTAGGGAGGGAGGGAGGGAGG - Intergenic
1141997550 16:87645037-87645059 TAGGAGGGCGAGGGGGCGGGGGG + Intronic
1142082480 16:88157546-88157568 TGGGAGGGGGTGGCGGAGGGTGG - Intergenic
1142161887 16:88562011-88562033 TAGAGGGGTGGGGGGGTGGGGGG - Intergenic
1142167813 16:88602203-88602225 TTGTAGGGTGTGCAGGAGGGTGG + Intronic
1142186782 16:88698461-88698483 GAGGAGGGCGTGGGGGAGGACGG + Intronic
1142274656 16:89111475-89111497 CCGAAGGGTGTGGCGGAGGGAGG - Intronic
1142369666 16:89671550-89671572 TCGTGGGGTAGGGGGGAGGGGGG - Intergenic
1142548169 17:720330-720352 TAGTAGGCGATGGGGGAGGATGG + Intronic
1142548211 17:720511-720533 CAGTAGGCTGTGAGGGAGGTGGG + Intronic
1142576418 17:911607-911629 TAGCCGGGTGTGGTGGTGGGCGG - Intronic
1142686024 17:1577418-1577440 TGGCAGGGTCTGAGGGAGGGGGG - Intronic
1142708523 17:1710711-1710733 TTGCAGGGTGTGGCGGTGGGTGG - Intergenic
1142907043 17:3050569-3050591 TAGTCGGGAGTGGTGGGGGGGGG - Intergenic
1143118072 17:4591776-4591798 TAGTAGTGGGTGGGGCAGGTGGG - Intronic
1143269088 17:5662449-5662471 TAGTTGGGGGTGGGGTGGGGCGG + Intergenic
1143434679 17:6914740-6914762 TAGGTGGGTGTGTGGGGGGGGGG - Intronic
1143591402 17:7887586-7887608 TGGTGCGTTGTGGGGGAGGGAGG + Intronic
1143611923 17:8022853-8022875 TCTGAGTGTGTGGGGGAGGGAGG + Intergenic
1144078879 17:11744302-11744324 TAGTAGGGTCTGTGGGAGAGTGG - Intronic
1144578893 17:16446924-16446946 TAGTTGTGGGTGGGGGTGGGGGG + Intronic
1144964574 17:19068303-19068325 TAGCAGGGGTTGGGGGAGGGAGG + Intergenic
1144983393 17:19183870-19183892 TAGCAGGGGTTGGGGGAGGGAGG - Intergenic
1144984832 17:19194369-19194391 TAGCAGGGGTTGGGGGAGGGAGG + Intergenic
1145846302 17:28041874-28041896 AAGCCGGGTGGGGGGGAGGGGGG + Intronic
1146478786 17:33185538-33185560 TTCTAGGTTGTGGTGGAGGGAGG + Intronic
1146691729 17:34881467-34881489 TTCTAGGGTTTGGAGGAGGGAGG - Intergenic
1146695109 17:34902995-34903017 GAGCAGGGTGGGGGAGAGGGAGG - Intergenic
1146831233 17:36070935-36070957 TAGGAGGCTGTGGAGAAGGGAGG - Exonic
1147034775 17:37671757-37671779 TGGGAGGGTGGGGGAGAGGGAGG - Intergenic
1147151886 17:38521305-38521327 TAGCTGGGTGTGGTGGCGGGCGG + Intergenic
1147257995 17:39193620-39193642 TGGTGGGGAGTGGTGGAGGGGGG - Intronic
1147306283 17:39566681-39566703 TAATGGGGAGTTGGGGAGGGGGG - Intergenic
1147376302 17:40024107-40024129 TGGTAGGGCGGGGGGGAAGGTGG + Intronic
1147425216 17:40342894-40342916 TTGTAGGGGGTGGGAGTGGGCGG + Intronic
1147513696 17:41096040-41096062 GGGTGGGGTGTGTGGGAGGGTGG + Intronic
1147610523 17:41799356-41799378 GGGTGGGGTGTGGGGGCGGGTGG + Intergenic
1147690767 17:42313064-42313086 TAGGAGGGGGCCGGGGAGGGAGG + Intergenic
1147976170 17:44249472-44249494 GGATAGGGAGTGGGGGAGGGTGG - Exonic
1148026247 17:44589754-44589776 TAGGAGGGTGTGGGTGGGAGGGG - Intergenic
1148153994 17:45412303-45412325 CATGAGGGTGTGGTGGAGGGAGG - Intronic
1148204802 17:45773556-45773578 TGGTTGGGTGGGGGGGATGGGGG - Intergenic
1148240693 17:45997880-45997902 TACGGGGGTGTTGGGGAGGGGGG + Intronic
1148382274 17:47208831-47208853 TGGGAGGGTGTGGGGCAGTGTGG + Intronic
1148397843 17:47324168-47324190 CAGTAGGGTGCGAGGGAGGAAGG + Intronic
1148564784 17:48626394-48626416 GAGCAGGGGGTGGGGGTGGGAGG - Intronic
1148602941 17:48908170-48908192 GAGGAGGGAGTGGGGGAGGAAGG - Intergenic
1148826233 17:50396511-50396533 TAGTAGGGCGTTGGCGCGGGTGG + Intronic
1148902311 17:50887584-50887606 GAGGGAGGTGTGGGGGAGGGGGG + Intergenic
1149153296 17:53595005-53595027 TTTCAGGGGGTGGGGGAGGGTGG + Intergenic
1149285573 17:55160614-55160636 CAGCAGGGTATGGGGGAAGGGGG - Exonic
1149299261 17:55289001-55289023 ATGTTGGGTGTGGGGAAGGGAGG + Intronic
1149387337 17:56155055-56155077 TAGGAGGGTTTGGGAGAGGGAGG + Intronic
1149394061 17:56220901-56220923 AGGAAGGGAGTGGGGGAGGGAGG + Intronic
1149419179 17:56491952-56491974 TAGTAAGGTATGGGGAAGTGGGG - Intronic
1149502787 17:57167181-57167203 TGGTAGGGTGGTGGGGAAGGGGG + Intergenic
1149536584 17:57438198-57438220 GAGTAGGGTGTGCGGAAGGCAGG + Intronic
1149644360 17:58228963-58228985 CGGTGGGGGGTGGGGGAGGGAGG - Intronic
1149768169 17:59297789-59297811 GAGTGGGGTGTGGGGGGCGGGGG + Intergenic
1149895065 17:60422647-60422669 AAGTGGGGTGTGAGGGAGGGAGG + Intronic
1149946709 17:60936002-60936024 TTGTGGGGTGGGGGGAAGGGGGG - Intronic
1150642496 17:66958981-66959003 TGGTTAGGTGAGGGGGAGGGAGG - Intergenic
1150703278 17:67466189-67466211 TGGTGGGGTGGGGGGGTGGGGGG + Intronic
1150807002 17:68327189-68327211 GAGTGGGGCGTGGGGGAGGGAGG + Intronic
1150871445 17:68916129-68916151 TAGTGGGGTGGTGGGGAAGGGGG + Intronic
1151135975 17:71945987-71946009 TTATAGTGTGTGGGGGGGGGTGG + Intergenic
1151155393 17:72120802-72120824 CGGTAGGGTGGGGGGGCGGGGGG - Intergenic
1151259244 17:72903869-72903891 TAGCAGGGTGAGAGGGAGGTGGG - Intronic
1151538300 17:74750765-74750787 TTGTGGGGGGTGGGGGTGGGTGG - Intronic
1152057191 17:78039310-78039332 AGGTAGGGAGTGGGGGGGGGGGG - Intronic
1152206681 17:78978007-78978029 TGGCAGGGTGTGGGGGAGGGAGG - Intronic
1152336117 17:79701048-79701070 TAGGAGGGTGGGGGAGAGGAGGG + Intergenic
1152628762 17:81400190-81400212 CAGGAGGGGGCGGGGGAGGGTGG - Intronic
1152884920 17:82844171-82844193 TAGTGGGGAGTGGAGGAGTGGGG + Intronic
1152922377 17:83072548-83072570 TGGTGGGGTGTGGGGGCTGGAGG + Intergenic
1153161561 18:2210397-2210419 TTGTGTGGTGGGGGGGAGGGGGG + Intergenic
1153211964 18:2777060-2777082 TATTAGGGTATGGGGGGGGGAGG - Intronic
1153227447 18:2909445-2909467 TAGGAGGGTGTGTGTGAGGCTGG - Intronic
1153320817 18:3772438-3772460 GAGGGGGGTGGGGGGGAGGGAGG - Intronic
1153408459 18:4766763-4766785 TTGTGGGGTGGGGGGGAGGGGGG + Intergenic
1153447710 18:5192784-5192806 TGGTGGGGTGAGGGGGAAGGGGG + Intronic
1153918342 18:9765946-9765968 GTGTAGGGGGTGGGGGAGAGTGG + Intronic
1153956739 18:10102626-10102648 GAGTGGGGTGTTGGGGAGTGGGG + Intergenic
1154432845 18:14321439-14321461 CAGTGGGGTGTGGGGGTGGTAGG + Intergenic
1155054072 18:22170091-22170113 TCGGAGCGAGTGGGGGAGGGAGG - Intronic
1155167524 18:23243422-23243444 TTGTGCTGTGTGGGGGAGGGAGG + Intronic
1155615528 18:27716925-27716947 GAGCAGGGAGTGGGGAAGGGTGG + Intergenic
1156259900 18:35436701-35436723 TAGCTGGGTGTGGTGGTGGGTGG + Intergenic
1156275160 18:35577194-35577216 TGGTCAGGTGTGGGGGTGGGGGG - Intergenic
1156432306 18:37089130-37089152 TAGGAGGGTGTGGTGGGGGAGGG + Intronic
1156497607 18:37536412-37536434 TAGGAGGGAGTGGGGGAGACAGG - Intronic
1157190577 18:45578078-45578100 TGGTAGGGTCTAGGGGAAGGGGG - Intronic
1157276106 18:46312030-46312052 AAGTTGGGTGTGGGGTTGGGGGG + Intergenic
1157496521 18:48161153-48161175 AAGGGGGCTGTGGGGGAGGGAGG + Intronic
1157544629 18:48539258-48539280 GAGTCGGGGGTGGGGGAAGGGGG - Exonic
1157650881 18:49329281-49329303 TTGTGGGGTGGGGGGGAGGGGGG + Intronic
1158400325 18:57115928-57115950 GAGTAGGGGCTGGGGGTGGGAGG + Intergenic
1158572743 18:58610767-58610789 TAATAGGGACGGGGGGAGGGGGG - Intronic
1158823861 18:61192110-61192132 TAGTTGGGGGGGGAGGAGGGGGG - Intergenic
1158841407 18:61392173-61392195 GAGTAGGGGGTGGGGTGGGGTGG - Intronic
1158876250 18:61737165-61737187 TATTAGGGGCTGGGGGAGTGGGG + Intergenic
1160380837 18:78454125-78454147 TAGTTGGGGGCGGGGGTGGGTGG - Intergenic
1160525997 18:79537758-79537780 TTGTAGGGTGCTGGGGATGGAGG - Intergenic
1160543114 18:79636139-79636161 TTGTGGGGTGGGGGGGAGGGGGG - Intergenic
1160767999 19:816995-817017 TAGATGGGTGGGTGGGAGGGTGG - Intronic
1160920811 19:1519596-1519618 TAGCCGGGTGTGGTGGCGGGCGG - Intergenic
1161013776 19:1973071-1973093 TAGCTGGGTGTGGTGGCGGGCGG - Intronic
1161254009 19:3296156-3296178 TAGTTGGGAGTGGGGTGGGGTGG + Intronic
1161394606 19:4038447-4038469 CAGTAGGGTGGGGGGATGGGTGG + Exonic
1161443336 19:4304763-4304785 TAGGACGGGGTGGGGCAGGGCGG + Intronic
1161731730 19:5964844-5964866 TGGTAGGGTGGGGGGGGGGGTGG + Intronic
1162122051 19:8476866-8476888 TGGGAGGGTGGGGGGGACGGCGG - Intronic
1162237728 19:9321772-9321794 GAGGAGGGTGGGGGGGAGGAGGG - Intergenic
1162566132 19:11446625-11446647 GACGAGGGTGTGGGGGAGGAGGG - Intronic
1162639560 19:11997459-11997481 GAGTAGGGTGAGGGAGAGGATGG + Intergenic
1162647235 19:12058786-12058808 TAATAAGTTGTGGGGGAGGCCGG - Intergenic
1162732010 19:12723988-12724010 TCGGAGGGTGGGGGAGAGGGAGG - Exonic
1162805942 19:13138131-13138153 CAGTAGTCTGTGGGGCAGGGTGG - Exonic
1162865714 19:13545168-13545190 TAGTGGGATGAGGGAGAGGGAGG - Intronic
1163047017 19:14650692-14650714 GTGTAGGGTGTGGGGGGGTGTGG - Intronic
1163166050 19:15499009-15499031 CAGTAGGGGGTGGGGGTGGGGGG + Intergenic
1163203880 19:15788029-15788051 TACTAAGTTGTGGAGGAGGGTGG + Intergenic
1163213717 19:15860942-15860964 TACCAGGGAATGGGGGAGGGGGG + Intergenic
1163392922 19:17041478-17041500 TAGCCGGGTGTGGTGGCGGGCGG - Intergenic
1163461440 19:17440370-17440392 TAGCCGGGTGTGGTGGCGGGCGG - Intronic
1163502697 19:17686304-17686326 TAGTGGAGTGGGGGGGGGGGGGG - Intronic
1163730192 19:18944544-18944566 AAAAAGGGTGGGGGGGAGGGAGG + Intergenic
1164430522 19:28184581-28184603 TAGCAGGGTGTGGTGGGGAGTGG - Intergenic
1164441098 19:28281624-28281646 AAGGAGGGTGTGGGGAAGGAAGG - Intergenic
1164464535 19:28476224-28476246 CAGTAGTGAGTGAGGGAGGGGGG - Intergenic
1164522240 19:28988437-28988459 AGGGAGGGAGTGGGGGAGGGAGG + Intergenic
1164586427 19:29478918-29478940 CAGTGGGGTCTGGGGAAGGGCGG - Intergenic
1164597126 19:29537691-29537713 TAGGTGGGTGTGGGGGCGGGTGG - Intronic
1164730578 19:30501109-30501131 TAGTAGGGTGTGGGGGTAGATGG - Intronic
1164798928 19:31059739-31059761 TGGTTGGGTGTGAGGGTGGGAGG + Intergenic
1165225258 19:34350237-34350259 CAGTGGGGTGTGGGTGAGGTAGG + Intronic
1165346154 19:35249781-35249803 GAGTAGGGTGAGGTGGTGGGAGG + Intronic
1165373733 19:35426840-35426862 CAGGAGGGGGTGGGGGTGGGGGG - Intergenic
1165394975 19:35558977-35558999 CAGTCAGGTGTGGGGGAGGGAGG - Exonic
1165463441 19:35958295-35958317 CAGCAGAGTGTGGGGTAGGGAGG + Intergenic
1165503902 19:36212437-36212459 TAGTAGAGACGGGGGGAGGGGGG - Intronic
1165803858 19:38568437-38568459 TAGGAGGGGGTGAGGGAGGCTGG + Intronic
1165812067 19:38617763-38617785 TTGTAGGGTGTTGGGGACAGAGG + Intronic
1166054831 19:40282148-40282170 AAGTAGGGGGTGGGGGAGGCTGG + Intronic
1166283305 19:41809226-41809248 AAGTAGGGAGGGAGGGAGGGAGG + Intronic
1166301748 19:41915126-41915148 CAATAGGGGGTGGGGGCGGGGGG - Intronic
1166403242 19:42499884-42499906 TAGCCGGGTGTGGTGGTGGGAGG + Intergenic
1166634010 19:44433426-44433448 TACTAGGAAGTGGGGGTGGGAGG + Intronic
1167008629 19:46791472-46791494 TAGTTGGGCGTGGTGGCGGGCGG + Intergenic
1167245884 19:48373057-48373079 AAGGAGAGTGTGGGGGAGGCAGG + Intronic
1167332140 19:48862653-48862675 TAGCCGGGTGTGGTGGCGGGGGG - Intronic
1167372255 19:49090184-49090206 TTGTAGGGGGTGGGGGTGGGAGG + Intronic
1167573973 19:50308931-50308953 TAGTGGGCTGTTGGAGAGGGAGG + Intronic
1167600454 19:50451604-50451626 CTGTAGGGTGTGAGGGAGGAGGG + Intronic
1167636694 19:50659769-50659791 GTGTAGGGGGTGGGGGGGGGAGG - Intronic
1167714949 19:51137254-51137276 GAGTCGGGGGTGGGGGATGGAGG - Intergenic
1167817688 19:51898532-51898554 AAGTGGGGGGTGGGGGAAGGGGG - Intronic
1168237391 19:55071899-55071921 TAGCAGCGGGTGGGGGAGGTAGG - Intergenic
1168245465 19:55111134-55111156 TCGTGGGGTGGGGGGGAGGGGGG + Intronic
1168341257 19:55624380-55624402 TATGAGGGGGTGGGCGAGGGAGG - Intronic
1168601677 19:57723714-57723736 CAGTAGGGTGGGGGGGAAGCTGG - Intronic
925508900 2:4602706-4602728 TTGGAGGGGGTGGGGTAGGGTGG - Intergenic
925665959 2:6256678-6256700 TGGTGGTGGGTGGGGGAGGGGGG - Intergenic
925740202 2:6998889-6998911 TTGTGGGGGGTGGGGGCGGGGGG + Intronic
925913014 2:8585668-8585690 TAGCCGGGCGTGGTGGAGGGGGG - Intergenic
925975141 2:9137144-9137166 TCCTAGGGTGTGTGCGAGGGTGG + Intergenic
925998972 2:9314958-9314980 TTGGAGGATCTGGGGGAGGGAGG + Intronic
926093335 2:10064590-10064612 TAGGAGGGAATTGGGGAGGGAGG - Intronic
926332344 2:11835983-11836005 AGGAGGGGTGTGGGGGAGGGGGG - Intergenic
926509075 2:13750586-13750608 TGTTGTGGTGTGGGGGAGGGGGG + Intergenic
926528107 2:14008067-14008089 TGGAAGGGTGTGGGGGTGAGAGG - Intergenic
926582748 2:14649187-14649209 GTGTAGGGGTTGGGGGAGGGGGG + Intronic
927232681 2:20840290-20840312 TAGTAGGTGGTGGATGAGGGAGG + Intergenic
927361971 2:22246419-22246441 TAGTAGGGGGTTGGGGGAGGTGG + Intergenic
927664925 2:25024786-25024808 TAGTTGGGTGTGGTGGCAGGGGG - Intergenic
927786216 2:25977035-25977057 ATGTAGTGTCTGGGGGAGGGAGG - Intronic
928020793 2:27703265-27703287 GAGTCGGGCCTGGGGGAGGGAGG - Intergenic
928121101 2:28584128-28584150 TCACAGGCTGTGGGGGAGGGAGG - Intronic
928237555 2:29557811-29557833 TTTTAGGGTGTGGGTTAGGGTGG + Intronic
928381125 2:30819662-30819684 TTGTGGGGTGGGGGGGAGCGGGG + Intronic
929317162 2:40493342-40493364 TTGTGGGGTGGGGGGGAGGGGGG + Intronic
929333747 2:40715000-40715022 TTTTAGGGTGTGGGGGGAGGGGG - Intergenic
929336686 2:40756623-40756645 AGGGAGGGAGTGGGGGAGGGAGG - Intergenic
929587669 2:43126588-43126610 TAATCTGGTGTGGGGGGGGGCGG + Intergenic
929783770 2:44974540-44974562 GAGAAGGGTGTGGAGGAGGAAGG + Intergenic
930020300 2:46997894-46997916 TTGGAGGGTTTGGGGGTGGGTGG - Intronic
930109738 2:47668261-47668283 AAGGTGGGTGTGGGGGAGGAGGG + Intergenic
930185548 2:48408972-48408994 AAGCAGTGTTTGGGGGAGGGGGG + Intergenic
930206519 2:48592575-48592597 TAGCTGGGTGTGGTGGTGGGTGG - Intronic
930596935 2:53400673-53400695 TGGTGGGGTCGGGGGGAGGGGGG + Intergenic
931115449 2:59162053-59162075 TGGTGGGGTGGGGGGGAGGGGGG - Intergenic
931313598 2:61105511-61105533 TAGCTGGGTGTGGTGGCGGGTGG - Intronic
931536680 2:63285286-63285308 TAGCCGGGTGTGGTGGCGGGTGG + Intronic
931648422 2:64446711-64446733 GAGAAGGGTGTGAGGGAGGCAGG + Intergenic
931846788 2:66212213-66212235 TTGTGGGGTGGGGGGGAGGGGGG + Intergenic
931910034 2:66889227-66889249 TAAGAGGGGGTGGGGGTGGGGGG - Intergenic
931929938 2:67120837-67120859 TTGTGGGGTGGGGGGGATGGGGG - Intergenic
931993924 2:67822054-67822076 TAGGAGGGTTTAGGGGAGAGTGG - Intergenic
931995929 2:67839122-67839144 TAGTATTGTTTGGGGGCGGGGGG - Intergenic
932023546 2:68112389-68112411 CAGAAGTGTGTCGGGGAGGGTGG - Intergenic
932356687 2:71073325-71073347 TGGCAGGGGGTGGGAGAGGGGGG - Intronic
932362629 2:71121678-71121700 TAGTGCAGTGTGGGAGAGGGGGG + Intronic
932399892 2:71473071-71473093 TAGGAAGGTGGGGTGGAGGGTGG + Intronic
932429562 2:71666029-71666051 GAGGAGGGGGTGGGGGATGGGGG - Intronic
932431283 2:71675135-71675157 TGCTAGGGATTGGGGGAGGGGGG + Intronic
932487162 2:72091152-72091174 TTGTAGGCTGTGGGGGAGCTGGG + Intergenic
932613965 2:73220215-73220237 TGGAAGGGGGTGGGTGAGGGAGG + Intronic
932692009 2:73921292-73921314 AAGCAGAGTGCGGGGGAGGGGGG + Intergenic
932955346 2:76345297-76345319 TCCTGGGGTGGGGGGGAGGGAGG - Intergenic
933109457 2:78379137-78379159 AAGGAGGGAGTGAGGGAGGGAGG + Intergenic
933406543 2:81867103-81867125 TAACACGGGGTGGGGGAGGGAGG - Intergenic
933436029 2:82251174-82251196 TTGCAGAGTGGGGGGGAGGGGGG - Intergenic
933725037 2:85421892-85421914 AGGTTGGGTGTGGGGGAGAGTGG - Intronic
933774958 2:85766330-85766352 GGGCTGGGTGTGGGGGAGGGAGG - Intronic
933887288 2:86730259-86730281 TTTTGGGGGGTGGGGGAGGGGGG + Intronic
933922887 2:87066454-87066476 TTTTGGGGGGTGGGGGAGGGGGG - Intergenic
934653349 2:96104573-96104595 GAGGAGGGTCTGTGGGAGGGTGG - Intergenic
934692826 2:96374873-96374895 TAGTGGGTTCTGGGGGTGGGGGG + Intergenic
934848153 2:97676599-97676621 TTGTCGTGTGTCGGGGAGGGGGG - Intergenic
934957723 2:98637576-98637598 TCTCAGGGTGTGGGGAAGGGAGG + Intronic
935493278 2:103746832-103746854 TTTTGGGGTGGGGGGGAGGGGGG - Intergenic
935588788 2:104826051-104826073 TTGTGGGGTGGAGGGGAGGGTGG - Intergenic
935589797 2:104835825-104835847 AGGCAGGGTGTGGGGGAGGTGGG + Intergenic
935732808 2:106078620-106078642 TATTTGGGTGAGGGAGAGGGAGG + Intergenic
935883169 2:107587164-107587186 TTGTGGGGTGGGGGGGAGGAGGG + Intergenic
936007677 2:108905522-108905544 CGGTGGGGTGTGGGGGTGGGAGG + Intronic
936053230 2:109241541-109241563 AAGAAGGTTGTGTGGGAGGGAGG - Intronic
936260375 2:110955397-110955419 TAGCTGGGGGTGGGGGATGGAGG - Intronic
936290632 2:111221074-111221096 TATTTGGGTGTGGGGGTGAGAGG - Intergenic
936521096 2:113212580-113212602 TCGGAGGGGGTAGGGGAGGGAGG + Intergenic
936581787 2:113706407-113706429 TAGGATGGTGGGGTGGAGGGAGG - Intronic
936679848 2:114757342-114757364 AAGTAGGGAGAGGGGGAGGGAGG + Intronic
937173410 2:119901288-119901310 CAGTAAGGTGTGGGACAGGGAGG - Intronic
937546661 2:123030365-123030387 TTGTGGGGTGGGGGGGAGTGGGG + Intergenic
938146354 2:128838023-128838045 TCCTAGGAGGTGGGGGAGGGGGG - Intergenic
938218189 2:129541044-129541066 TTGTAGGGTGGGGGGGAGGAGGG + Intergenic
938494464 2:131786239-131786261 TTGTAGGGTGGTGGGGAGTGGGG - Intergenic
939261809 2:139820429-139820451 TTGTGGGGTGGGGGGGAGGGGGG - Intergenic
939275081 2:139990302-139990324 TAGCAGGATGTGGGTGCGGGGGG - Intergenic
939629175 2:144513971-144513993 GAGTGGGGTGAGGGGGAAGGAGG - Intronic
940382061 2:153026389-153026411 GACAAGGGTTTGGGGGAGGGAGG - Intergenic
940659011 2:156523546-156523568 TAGTGGGGAGTGGGGGAAAGGGG - Intronic
940694579 2:156962482-156962504 TTGTGGGGTGGGGGGGGGGGAGG - Intergenic
940750641 2:157623606-157623628 TAGTAGGGGGTTGGTGGGGGAGG + Intronic
940809727 2:158228805-158228827 TTGTGGGGTTGGGGGGAGGGGGG + Intronic
941150036 2:161903584-161903606 TAGCAGGAAGTGAGGGAGGGAGG - Intronic
941339364 2:164287170-164287192 TAGAAGGGAGGGAGGGAGGGAGG + Intergenic
941671865 2:168302364-168302386 TAATAGGGTGGGGTGGAGTGAGG + Intergenic
942072406 2:172327777-172327799 TAGTGGAGTGTGGGGGAAGTGGG + Intergenic
942135983 2:172925947-172925969 AAGGAGGGGGAGGGGGAGGGGGG + Intronic
942633725 2:177978923-177978945 TGGTGGGGTCGGGGGGAGGGGGG + Intronic
942640431 2:178055344-178055366 TCATGGGGTGGGGGGGAGGGAGG + Intronic
942684267 2:178514321-178514343 TAAGAGGGTGTGGGGAATGGTGG + Exonic
942821328 2:180119229-180119251 GTGGGGGGTGTGGGGGAGGGCGG + Intergenic
942849975 2:180472830-180472852 AAGTAGGGAGGGAGGGAGGGAGG - Intergenic
942875177 2:180786496-180786518 TTGTGGGGTGGGGGGCAGGGGGG + Intergenic
943161134 2:184252651-184252673 TCGTGGGGCATGGGGGAGGGAGG + Intergenic
943311459 2:186330188-186330210 TACTGGGGTCTGGGGGAGGTAGG - Intergenic
943651763 2:190464904-190464926 TTGGTGGGGGTGGGGGAGGGTGG + Intronic
944153890 2:196591627-196591649 GGGTAGGGTGGGGTGGAGGGTGG - Intronic
944329594 2:198449954-198449976 TGTTATGGGGTGGGGGAGGGGGG - Intronic
944416370 2:199483703-199483725 TAGCCGGGTGTGGGGGTGGCGGG - Intergenic
944468987 2:200032960-200032982 TAATGGGGAGTGGGGTAGGGAGG + Intergenic
944585873 2:201173351-201173373 TAGCCGGGCGTGGTGGAGGGCGG - Exonic
944927470 2:204479764-204479786 TGCAATGGTGTGGGGGAGGGGGG - Intergenic
944972042 2:205003971-205003993 AAGTGGGGTCTGGGGCAGGGAGG + Intronic
945941683 2:215957425-215957447 GAGGAGAGTGTGGGGGAGGGAGG - Intronic
946026289 2:216673731-216673753 TGGCAGGGTGTGAGGGAGGCAGG - Exonic
946109627 2:217403192-217403214 GAGAAGGGAGAGGGGGAGGGAGG + Intronic
946335509 2:219032748-219032770 TAGGAGGGGGAGGAGGAGGGTGG - Intronic
946366804 2:219253702-219253724 CAGGAGGGGGTTGGGGAGGGAGG + Intronic
946415748 2:219538905-219538927 TAGGCAGGCGTGGGGGAGGGAGG - Intergenic
946442381 2:219707319-219707341 TAGTAGGGAATGGGGGATAGGGG + Intergenic
946591802 2:221257669-221257691 TATTGTGGGGTGGGGGAGGGGGG + Intergenic
946613198 2:221481320-221481342 TGGGAGGGTGGGGCGGAGGGTGG - Intronic
946852668 2:223922156-223922178 TGGTAGGGTGGGGAGGAAGGTGG - Intronic
947008263 2:225537122-225537144 TAGTAGGGGGTTGGGGAAAGTGG - Intronic
947272972 2:228359112-228359134 TTGTGGGGTGGGGGGAAGGGGGG - Intergenic
947305484 2:228741560-228741582 TGGTGGGGTTGGGGGGAGGGGGG - Intergenic
947388234 2:229614023-229614045 TTGTGGGGTGGGGGGGAGCGGGG + Intronic
947400809 2:229729794-229729816 TTGTAGGGTGGGGGGAGGGGGGG + Intergenic
947456245 2:230256518-230256540 TATTGTGGGGTGGGGGAGGGGGG + Intronic
947692838 2:232155321-232155343 TGGGAGGGTGAGGAGGAGGGAGG - Intronic
947819483 2:233060196-233060218 TGGCAGGGTGTAGGGGACGGTGG + Exonic
948128202 2:235580447-235580469 TTGGAGGCAGTGGGGGAGGGAGG + Intronic
948925622 2:241095064-241095086 AAGGTGGGTGTGGGGGGGGGGGG - Exonic
1168909706 20:1438088-1438110 TAGTGGGGAGGGAGGGAGGGAGG + Intergenic
1168950003 20:1790989-1791011 TGCTAGAGTGTGGGGGACGGAGG - Intergenic
1169998926 20:11593131-11593153 GAGTGGGGTGGGGTGGAGGGGGG - Intergenic
1170157567 20:13282543-13282565 TAGGAGGCTGGGGGTGAGGGTGG - Intronic
1171204253 20:23266871-23266893 TAGTAGGAAGGGGGGGTGGGAGG + Intergenic
1171208955 20:23302433-23302455 TGGTAGGGAGTGGGGGCGGGGGG - Intergenic
1171239593 20:23554234-23554256 TAGTAGGGTGGGGAGGGAGGGGG - Intergenic
1171249982 20:23639486-23639508 CATTAGGGTGTGTGGGAGGATGG + Intergenic
1171341497 20:24432170-24432192 TAGAAGGCTGTGGGGGAGTTTGG - Intergenic
1171842354 20:30230150-30230172 TCGTGGGGTAGGGGGGAGGGGGG - Intergenic
1171869376 20:30513390-30513412 TGGTGGCGTGTGGGGGAGGAGGG - Intergenic
1171942620 20:31346769-31346791 GGGTAGGGGGTGGGGCAGGGTGG - Intergenic
1172113941 20:32562933-32562955 AAGGAGGGTGGAGGGGAGGGAGG + Intronic
1172155415 20:32820346-32820368 TGGGAGGGTGTGGGCGAGGTGGG + Intronic
1172269095 20:33643131-33643153 TGGTCTGGTGTGGGGGAGGAAGG + Intronic
1172404156 20:34675334-34675356 TAGTAGGGTGTAGAGGAAGAAGG + Intronic
1172474685 20:35227378-35227400 GAGAAGGGGGAGGGGGAGGGCGG + Intronic
1172619346 20:36308948-36308970 TAGTTGGGGGAGGGGGAGGTTGG - Intronic
1172891240 20:38266991-38267013 TGGTGGGGGGTGGGGGTGGGGGG + Intronic
1172897593 20:38311503-38311525 TAGGGAGGTGTTGGGGAGGGGGG + Intronic
1173006331 20:39142444-39142466 TGGTGTGGTGAGGGGGAGGGAGG + Intergenic
1173183610 20:40822444-40822466 GAGAAGGGTGTTGGGGAGGGAGG - Intergenic
1173952325 20:47003119-47003141 TTGTGGTGTCTGGGGGAGGGTGG + Intronic
1174098694 20:48109987-48110009 TAGAAGGGTGAAGGGGTGGGTGG - Intergenic
1174384007 20:50176031-50176053 GAGTAGGTTGTAGGGGATGGGGG - Intergenic
1174540684 20:51286930-51286952 CAATAGGGGGTGGGGGAAGGAGG - Intergenic
1175367672 20:58467072-58467094 TGTTGGGGTGTGGGAGAGGGGGG - Intronic
1175382164 20:58570849-58570871 TGGTGGGGGGTGGGGGAGGGGGG - Intergenic
1175932205 20:62498332-62498354 TGGGTGGGTGTGGGGGTGGGTGG + Intergenic
1175932370 20:62498792-62498814 TGGTTGGGTGTTGGGGTGGGTGG + Intergenic
1176000910 20:62830758-62830780 TGGTAGGGGGTGGGGGACTGTGG - Intronic
1176009175 20:62882780-62882802 CAGTAGTGTGGAGGGGAGGGAGG + Intronic
1176050072 20:63114374-63114396 CGGTAGGGTGTGGGGAAGGAAGG + Intergenic
1176128577 20:63486892-63486914 GAGGAGGGTGGGGTGGAGGGTGG - Intergenic
1176128593 20:63486935-63486957 GAGGAGGGTGGGGTGGAGGGTGG - Intergenic
1176128663 20:63487151-63487173 GAGGAGGGTGGGGTGGAGGGTGG - Intergenic
1176139394 20:63538353-63538375 CAGTAGGGTCAGTGGGAGGGTGG - Intergenic
1176227861 20:64012940-64012962 AAAAAGGGTGTGGGGGAGAGGGG - Intronic
1177020400 21:15848535-15848557 TATTGGGTAGTGGGGGAGGGGGG + Intronic
1177080379 21:16632026-16632048 TAGTGGAGTGTGGTGGAAGGGGG - Intergenic
1177453719 21:21306827-21306849 TAGTAGGGGGTTGGGGGAGGAGG - Intronic
1177580920 21:23021320-23021342 CAGCAGGATGTGGGGGGGGGGGG - Intergenic
1177597261 21:23261344-23261366 TGCGGGGGTGTGGGGGAGGGGGG - Intergenic
1177708235 21:24736979-24737001 TTGTGGGGTGGGGGGGAGGGGGG + Intergenic
1177859465 21:26435907-26435929 TTGTAGGGGATGGGGGAGAGAGG + Intergenic
1177995729 21:28094858-28094880 TAGATGGGGGTGGGGGAGTGAGG + Intergenic
1178245148 21:30943348-30943370 TATAAGGGTGTGGGGGGGGAGGG + Intergenic
1178256301 21:31055443-31055465 TCGTAGTGTCTGGAGGAGGGAGG - Intergenic
1178412651 21:32378305-32378327 TTGAAGGATGTGGGGCAGGGAGG - Intronic
1178414257 21:32391214-32391236 TTGTCGGGTCGGGGGGAGGGGGG + Intronic
1179030131 21:37712800-37712822 TAGTTGGGTGGGGAGGAGGAAGG - Intronic
1180068722 21:45425510-45425532 CAGGAGGGTGTGGGTGAGTGGGG - Intronic
1180112150 21:45664761-45664783 TGGTGGGGTGGGGGGGAGGGGGG - Intronic
1180371772 22:12044736-12044758 TTGTGGGGTGGGGGGGAGTGGGG + Intergenic
1181180228 22:21062565-21062587 TAGCCGGGTGTGGTGGTGGGCGG + Intronic
1181257482 22:21573219-21573241 TAGTAGGGTGAGGATGAGGCTGG + Intronic
1181329046 22:22075015-22075037 TCCTAGGGTCTGGTGGAGGGGGG - Intergenic
1181453334 22:23038352-23038374 TGGTGTGGTGTCGGGGAGGGTGG + Intergenic
1181506108 22:23358757-23358779 TATTGGGGTCTGGGGGAAGGAGG + Intergenic
1182045884 22:27273911-27273933 CGGTGGGGTGGGGGGGAGGGGGG - Intergenic
1182134663 22:27890219-27890241 ATGGAGGGTGTGGGGGTGGGCGG - Intronic
1182151789 22:28032731-28032753 TTTTAGGGGGAGGGGGAGGGAGG - Intronic
1182155778 22:28071579-28071601 TGGTGGGGTGGGGGGGAGCGGGG + Intronic
1182189724 22:28446263-28446285 GAATGGGGTGTGGGGGTGGGAGG + Intronic
1182193737 22:28492107-28492129 TTGTGGGGTGGGGGGGAGCGGGG + Intronic
1182419569 22:30242317-30242339 CAGTAGGGGATGGGGGGGGGTGG + Exonic
1183220669 22:36510601-36510623 AAGCAGGGTGTGGGTGAGGTGGG - Intergenic
1183225866 22:36549459-36549481 TATTTGGGTGGGGGAGAGGGAGG + Intergenic
1183307840 22:37092447-37092469 TACTCGGGGGTGGGGGTGGGGGG - Intronic
1183404472 22:37623690-37623712 TAGCAGGGCCTGGGGGAGGTGGG - Intronic
1183784656 22:40022470-40022492 CAGTAGGGTACAGGGGAGGGTGG - Intronic
1184919488 22:47595723-47595745 TAGCCGGGTGTGGTGGTGGGAGG - Intergenic
1184966168 22:47973746-47973768 TGGCAGGGGGTGGGGGAAGGGGG + Intergenic
1185058333 22:48592654-48592676 GAGGAGGGAGTGAGGGAGGGAGG - Intronic
1185276050 22:49950556-49950578 TAGGGGGGTGGGGGGGTGGGGGG + Intergenic
1185326637 22:50228846-50228868 GAGGAGGGTGTTGGGGAAGGTGG - Intronic
1185345184 22:50307765-50307787 AAGGAGGGGGAGGGGGAGGGGGG + Intergenic
1185373299 22:50470642-50470664 CACTGGGGTGTGGTGGAGGGAGG - Intronic
1185417929 22:50720297-50720319 TAGTAGGGCGCGGGCGGGGGAGG - Intergenic
949339651 3:3015344-3015366 CTGTTGGGGGTGGGGGAGGGAGG + Intronic
949489228 3:4571874-4571896 GAGTAGGGAGTGGGGCAGAGGGG - Intronic
949704787 3:6803834-6803856 TGGAAGGGGGTTGGGGAGGGAGG - Intronic
949937421 3:9126767-9126789 CAGAAGGGTGAGGGGGTGGGAGG + Intronic
950530813 3:13551328-13551350 TGCTAGGCTGTGGGGGACGGTGG + Intronic
950595741 3:13979813-13979835 TAGCTGGGTGTGGTGGTGGGTGG - Intronic
950709368 3:14803867-14803889 TTGTGGAGGGTGGGGGAGGGTGG - Intergenic
950988211 3:17400083-17400105 TAGTGTGGTGTCGGGGAGAGTGG - Intronic
951016710 3:17740180-17740202 TAGTCGGGAGTGGTGGCGGGCGG + Intronic
951126175 3:18985991-18986013 GTGAAGGGTGTGGGGGTGGGGGG + Intergenic
951150852 3:19288374-19288396 TTGTGGGGTGTGGGGACGGGGGG - Intronic
951291200 3:20874060-20874082 TTGTGGGGTTGGGGGGAGGGGGG - Intergenic
951617175 3:24560293-24560315 TAGTAGGATGTGGAGTAGGGAGG - Intergenic
951830157 3:26917607-26917629 TTGTCGGGTGGGGAGGAGGGGGG - Intergenic
951901742 3:27664171-27664193 GACTAGGGTGTGTGGGAGGGTGG - Intergenic
952261738 3:31746820-31746842 TTGTGGGGTGGGGGGGAGGGAGG + Intronic
952414673 3:33080223-33080245 TAGCCGGGTGTGGGGGCAGGAGG - Intronic
952731417 3:36640469-36640491 GAAAAGGGTGTGGGGGAGAGGGG - Intergenic
953125617 3:40088988-40089010 GCAGAGGGTGTGGGGGAGGGAGG + Intronic
953582668 3:44171580-44171602 GAGTGGGGTGGGTGGGAGGGTGG - Intergenic
953933019 3:47015966-47015988 TGGGGGGGGGTGGGGGAGGGGGG - Intergenic
953935371 3:47037275-47037297 TTGTGGGGTGGGGGGGAGGGGGG - Intronic
954003799 3:47577550-47577572 TCGCCGGGGGTGGGGGAGGGTGG + Exonic
954436510 3:50499083-50499105 TTGCAGGGAGTGAGGGAGGGAGG + Intronic
954911587 3:54115111-54115133 TAGTGGGGTGTGGGCTAGAGTGG - Intergenic
954971691 3:54656665-54656687 TAGCAGGGTGTCAGGGAGTGGGG - Intronic
955239434 3:57165869-57165891 CAGGAGGGTGAGGGGGACGGGGG - Intronic
955605251 3:60694911-60694933 TTGTGGGGTGTGGGGGTGGGAGG + Intronic
955971018 3:64438783-64438805 TTTTAGGGGGTGGGGGTGGGGGG - Intronic
956296920 3:67725027-67725049 AAAGAGGTTGTGGGGGAGGGGGG - Intergenic
956555789 3:70521065-70521087 CAGTCGGGGGTGGGGGTGGGTGG + Intergenic
956791492 3:72683502-72683524 TGGCAGGGGGTGGGGGTGGGGGG + Intergenic
956976785 3:74589954-74589976 TTGTGGGGTGGGGGGGAGGGGGG + Intergenic
957031218 3:75244024-75244046 TAGTGGGGTGCGGGGGTTGGGGG - Intergenic
957150314 3:76478172-76478194 TTGTGGGGTGGGGGGGAGGGGGG - Intronic
957284143 3:78195572-78195594 TTGTGGGGTGGGGGGGAGAGGGG + Intergenic
957345801 3:78959935-78959957 TTTTGGGGAGTGGGGGAGGGTGG + Intronic
957367299 3:79242977-79242999 TTGTGGGGTGGGGGGGAGGGGGG - Intronic
957657765 3:83103680-83103702 TAGCTGGGTGTGGTGGTGGGCGG + Intergenic
957869975 3:86078841-86078863 TATTACAGTGTGGGGGTGGGGGG + Intergenic
957880536 3:86206303-86206325 TTGTGGGGTGGGGGGAAGGGAGG + Intergenic
958186382 3:90125264-90125286 TTATGGGGTGGGGGGGAGGGGGG + Intergenic
958635582 3:96739950-96739972 TTGTGGGGTGGGGGGGAGGGGGG + Intergenic
958838831 3:99178424-99178446 TAGTGGGGTGTTGGGTGGGGGGG + Intergenic
959119657 3:102217572-102217594 TTGTGGGGTGGGGGGGAGGGGGG + Intronic
959352294 3:105281099-105281121 CAGAAGGATGTGGGGGAGGAAGG + Intergenic
959604508 3:108227425-108227447 TGGTCGGGGGTGGGGGTGGGTGG + Intergenic
959618716 3:108377158-108377180 TAGTAGTGTTTTGGGGTGGGCGG - Intronic
959863363 3:111240416-111240438 TTATGGGGTGGGGGGGAGGGGGG - Intronic
959992364 3:112643482-112643504 TGCTAGGGGTTGGGGGAGGGTGG + Intronic
960049240 3:113224559-113224581 TTGGAGGGGGTGGGGGTGGGGGG + Intronic
960223945 3:115147809-115147831 CAGTAGGGGGTGGGGGAGATGGG - Intergenic
960580617 3:119275561-119275583 TAGGAGGCTGGGGAGGAGGGCGG - Intergenic
960868967 3:122230523-122230545 TTGCAGGGGGTGGGGGATGGTGG - Intronic
960934603 3:122890377-122890399 AATGAGGGTGTGAGGGAGGGAGG + Intergenic
961345488 3:126260797-126260819 AAGAAGGGTGGGGAGGAGGGGGG - Intergenic
961441863 3:126958151-126958173 CAGTTGGGGGTGGGGGAGGAAGG - Intronic
961640331 3:128360903-128360925 CAGCAGGGAGTGGGGGTGGGAGG - Intronic
962126373 3:132624000-132624022 TTTTCGGGGGTGGGGGAGGGTGG - Intronic
962158227 3:132971622-132971644 TGCTAGGGGATGGGGGAGGGGGG + Intergenic
962317473 3:134367703-134367725 CAGCTGGATGTGGGGGAGGGGGG + Exonic
963131409 3:141861704-141861726 GGGTAGGGTGTGTGGGAAGGTGG + Intergenic
963216921 3:142758821-142758843 TATTGTGGGGTGGGGGAGGGGGG - Intronic
963579562 3:147108478-147108500 TTGTTGTGGGTGGGGGAGGGGGG - Intergenic
964080298 3:152746082-152746104 AAGTTGGGTCTGGGGGAGGTTGG + Intergenic
964087282 3:152834131-152834153 TGGTAGGGGGTGGCGGGGGGAGG - Intergenic
964144847 3:153447298-153447320 TTGTGGGGTGGGGGGGAGGAAGG + Intergenic
964313659 3:155420628-155420650 TGGTTGGGGATGGGGGAGGGAGG - Intronic
964584662 3:158284036-158284058 TTGTGGGGTGGGGGGAAGGGGGG - Intronic
964645818 3:158957437-158957459 TGGTGGGGTGGGGGGGAGGGGGG - Intergenic
964771879 3:160232877-160232899 TAGTGGGGGGTGGGGGGGTGCGG - Intronic
964949611 3:162273741-162273763 TAGAAGGGTGAGGGAGGGGGAGG - Intergenic
965018348 3:163191357-163191379 TTGTGGGGTGGGGGGGAGTGGGG - Intergenic
965223567 3:165958972-165958994 TTGTGGGGTGGGGGGAAGGGGGG - Intergenic
965334324 3:167417807-167417829 TGGTGGGGTGTGGGGTGGGGGGG - Intergenic
965668313 3:171119794-171119816 TTGTGGGGTTGGGGGGAGGGAGG + Intronic
965718587 3:171634938-171634960 TAATAGGGTGTAGAGGAGAGTGG - Intronic
966419766 3:179726092-179726114 TGGTAGGGAGTGAGGAAGGGTGG + Intronic
966448485 3:180030633-180030655 TAAGAGGGTGTGTGGGAGTGGGG + Intronic
966694077 3:182771574-182771596 TGGAAGGGTGTGTGGGTGGGAGG - Intergenic
967106823 3:186260979-186261001 TGTTGGGCTGTGGGGGAGGGAGG + Intronic
967261585 3:187648012-187648034 TAGCTGGGTGTGGTGGAAGGCGG + Intergenic
967683743 3:192395981-192396003 GAGTAGTATGTGGGGAAGGGTGG + Intronic
967694556 3:192515358-192515380 AACTAGGGGGTGGGGTAGGGAGG + Intronic
968131688 3:196196049-196196071 AACCAGGGTGTGGAGGAGGGTGG - Intergenic
968213606 3:196869157-196869179 GAGGAGGGTGCTGGGGAGGGGGG + Intronic
968227661 3:196985274-196985296 TGGTGGGGTGAGGGGGAGGTGGG + Intergenic
968373377 4:15948-15970 TTGTGGGGTGGGGGGGAGGGGGG + Intergenic
968597676 4:1493687-1493709 CAGAAGTGGGTGGGGGAGGGAGG - Intergenic
968845668 4:3040293-3040315 TAGCAGGGTGTGGTGGCGTGTGG + Intronic
968920291 4:3518845-3518867 CAGGAGGGGGTGGGGGCGGGGGG + Intronic
969196462 4:5567284-5567306 GACCAGGGTGAGGGGGAGGGTGG - Intronic
969215775 4:5721144-5721166 TAGTAGTGTGAGAGGGTGGGAGG - Intronic
969658022 4:8509217-8509239 GAGTGGGGTGGGAGGGAGGGAGG + Intergenic
969686364 4:8676715-8676737 GAATAGGTTGTAGGGGAGGGAGG - Intergenic
969902670 4:10364235-10364257 TAGTATGGGGGGGGGGGGGGGGG - Intergenic
969905286 4:10387880-10387902 TTGTGGGGTGGGGGGAAGGGGGG + Intergenic
970346988 4:15161933-15161955 TGGCAGGGGGTGGGGGAAGGAGG + Intergenic
970626972 4:17896857-17896879 TAGTGGGGGGTGGGGTAAGGAGG - Intronic
971537553 4:27772526-27772548 TTGTGGGGTTGGGGGGAGGGGGG + Intergenic
971573294 4:28241673-28241695 TTCTAGGCTGTGGTGGAGGGAGG + Intergenic
971650075 4:29260013-29260035 TAGCAGGGGGTGGGGTAGGTGGG + Intergenic
971875977 4:32308719-32308741 TAGCTGGGTGTGGTGGTGGGGGG + Intergenic
971920778 4:32936746-32936768 TGGTGGGGAGGGGGGGAGGGGGG - Intergenic
972225984 4:37012520-37012542 GAGTAGGGTGAGGGCAAGGGTGG + Intergenic
972511085 4:39769674-39769696 AAGAAGGGTGGGGGGGTGGGTGG - Intronic
972566181 4:40271113-40271135 TAGCAGGGCGTGGTGGTGGGGGG - Intergenic
973085644 4:46055950-46055972 TGGTGGGGTCGGGGGGAGGGGGG + Intronic
973093671 4:46169910-46169932 CTGTGGGGTGAGGGGGAGGGCGG + Intergenic
973592047 4:52452318-52452340 TTGTGGGGTGGGGGGGGGGGAGG + Intergenic
974125980 4:57696296-57696318 GAGTATGGGGTGGGGGAGGAGGG - Intergenic
974296882 4:60011742-60011764 TTGTGGGGTGGGGGGGGGGGAGG + Intergenic
974339560 4:60598044-60598066 GTGTAGGGTGTGGGGGTGGGCGG - Intergenic
974835097 4:67238806-67238828 AAGTAGGGAGAGAGGGAGGGAGG - Intergenic
975040410 4:69739157-69739179 TTCTAGGGTCTGGGGGATGGTGG + Intronic
975373868 4:73620079-73620101 TTGTAGGGTGGGAGGGAGAGAGG - Intronic
975430562 4:74285187-74285209 TTGTGGGGTGAGGGGGATGGGGG + Intronic
975515307 4:75240834-75240856 TTGTGGGGTGGGGGGGAGGGGGG + Intergenic
975541936 4:75522571-75522593 TAGTAGGATGGGGGGGAGGTGGG - Intronic
975553984 4:75641205-75641227 TAGGAGGCTGAGGGGGTGGGGGG + Intergenic
975573261 4:75838869-75838891 GAGGAGGGTGTGGGGGAGGGTGG + Intergenic
975767789 4:77687188-77687210 TTGTGGGGTGGGGGGGAGGGGGG + Intergenic
975808014 4:78133380-78133402 TAGTGGGGTGGGAGGGAGGTAGG + Intronic
975933370 4:79553872-79553894 AAGGAGGGAGTGAGGGAGGGAGG - Intergenic
975993284 4:80283428-80283450 TTGTAGGGGGTGGGGCAGGTGGG + Intronic
976126022 4:81834517-81834539 TGCGAGGGAGTGGGGGAGGGTGG + Intronic
976507804 4:85869522-85869544 TTGGATGGGGTGGGGGAGGGAGG + Intronic
976630964 4:87235900-87235922 GAGGAGGGTGCGGGGGAAGGGGG + Intronic
976663486 4:87564975-87564997 TGGTGGGGTCGGGGGGAGGGGGG + Intergenic
978795074 4:112700758-112700780 TTGAAGGGTGAGGGGGTGGGAGG + Intergenic
979264419 4:118684796-118684818 CAGTAAGGTGTGGGGAAGAGTGG + Intergenic
979267949 4:118725388-118725410 TAGTGGCATGTGGGAGAGGGTGG - Intronic
979379068 4:119987038-119987060 TAGTGGGAGGTGGGGGATGGTGG + Intergenic
979557233 4:122062767-122062789 TGGGAGGGTGGTGGGGAGGGAGG - Intergenic
979566943 4:122165216-122165238 TCATAGGGTGCGGGGGAGAGGGG - Intronic
979577799 4:122315929-122315951 GAGTAGGGAGTGGGGCAGGGTGG + Intronic
980607198 4:135108807-135108829 TTGTGGGGTGGGGGGGAGTGGGG - Intergenic
980795265 4:137674563-137674585 TTGTGGGGTGGGGGGAAGGGGGG - Intergenic
981361522 4:143851081-143851103 GGGTAGGGTGTGGGGGAGGGAGG + Intergenic
981372267 4:143972075-143972097 GGGTAGGGTGTGGGGGAGGGAGG + Intergenic
981381345 4:144075274-144075296 GGGTAGGGTGTGGGGGAGGGAGG + Intergenic
981459933 4:145001229-145001251 AAGGAGGGAGTGAGGGAGGGAGG + Intronic
981509865 4:145544190-145544212 TAGGAAGGTGTGGGGGTGGGGGG + Intronic
981587707 4:146322365-146322387 TGTTATGGGGTGGGGGAGGGGGG - Intronic
981625118 4:146746853-146746875 TTTTAGGGGGTGGAGGAGGGAGG - Intronic
981783161 4:148447811-148447833 TAATGGGATGGGGGGGAGGGAGG - Intergenic
981928380 4:150164369-150164391 GAGTAGGGTATGGGGGTAGGGGG - Intronic
982008258 4:151083333-151083355 TGGGAGGCTGTGGGGCAGGGCGG + Intergenic
982258071 4:153468738-153468760 CAGGAGGGGGTGGGGGAGAGGGG - Intronic
982265711 4:153536723-153536745 TAGAAGGGAGGGAGGGAGGGAGG - Intronic
982581757 4:157187938-157187960 AGGTAGGCAGTGGGGGAGGGTGG - Intergenic
982678314 4:158400770-158400792 TAGAAGTGGGTGAGGGAGGGAGG + Intronic
983723804 4:170893352-170893374 TTCTAGGGTCTGGAGGAGGGTGG + Intergenic
983913427 4:173265667-173265689 GGGTGGGGGGTGGGGGAGGGAGG - Intronic
984188417 4:176575260-176575282 TAAGAGAGTGTGGGGGAGGATGG - Intergenic
984351135 4:178595345-178595367 TTGTGGGGTGGGGGGGAGCGGGG - Intergenic
984676055 4:182548886-182548908 TGGTAGGGGATGGGGAAGGGTGG - Intronic
985039845 4:185879163-185879185 TCGTGGGGTGGGGGGGGGGGAGG - Intronic
985066149 4:186124407-186124429 TTGTGGGGTGGGGGGGAGCGGGG - Intronic
985116435 4:186596597-186596619 TTGAAGGGGGTGGGGGAGGCAGG + Exonic
985239346 4:187913545-187913567 TAGCCGGGTGTGGTGGCGGGCGG - Intergenic
985648566 5:1096766-1096788 AAGGAGGGAGGGGGGGAGGGAGG + Intronic
985965402 5:3335697-3335719 GCGTGGGGTGTGTGGGAGGGTGG - Intergenic
986297274 5:6449589-6449611 GAGGAGGGTATGGGAGAGGGAGG - Intronic
986323221 5:6650787-6650809 TTGTGGGGTGGGGGGGAGGGGGG - Intronic
986508060 5:8473434-8473456 AAATGGGGTCTGGGGGAGGGGGG + Intergenic
986547800 5:8918113-8918135 TACTAGGATGTGAGGGAGGGAGG + Intergenic
986799734 5:11246716-11246738 TAGGTGGGTGGGGGGGTGGGGGG + Intronic
987203955 5:15605566-15605588 TACTAGGGGCTAGGGGAGGGAGG + Intronic
987640709 5:20608306-20608328 TAATAGTGTGTGGGGCGGGGAGG - Intergenic
987750285 5:22030110-22030132 TTGTGGGGTGGGGGGGAGGGGGG + Intronic
987880189 5:23734431-23734453 TGGTGGGGTGGGGGGAAGGGGGG - Intergenic
988011458 5:25492667-25492689 TCGTGGGGTGGGGGGGTGGGGGG - Intergenic
988086567 5:26481897-26481919 TTGTGGGGTGGGGGGGAGGGGGG + Intergenic
988421868 5:31015558-31015580 TAGTGGGGGGTGGGGGGGCGGGG + Intergenic
988528047 5:32003461-32003483 TAGTGTGGTGTGGGGGGGGTGGG - Intronic
989143453 5:38224761-38224783 TTGTGGGGTGGGGGGGAGGAGGG + Intergenic
989254196 5:39349018-39349040 TTGTGGGGTGGGGGGGAGGGGGG + Intronic
989444431 5:41510777-41510799 GAGGAGGGGGTTGGGGAGGGAGG - Intergenic
989564567 5:42889326-42889348 GAGTAGGGGGTGCGGGAGGATGG - Intergenic
989617560 5:43352239-43352261 CAGTAGGGGGTGGGGTGGGGTGG + Intergenic
989702431 5:44286254-44286276 TTGTGGGGTGGGGGGGAGAGGGG - Intergenic
989778592 5:45237996-45238018 TGATGGGGGGTGGGGGAGGGGGG - Intergenic
989850234 5:46199275-46199297 TTGTGGAGTGGGGGGGAGGGGGG + Intergenic
990089171 5:52019609-52019631 TTGTGGGATGGGGGGGAGGGGGG + Intronic
990102068 5:52202825-52202847 TAGCTGGGTGTGGTGGAGGAAGG + Intergenic
990363327 5:55043732-55043754 TGTTGGGGTGTGGGGGAGTGGGG - Intergenic
990676695 5:58194424-58194446 GGGTAGGGGGAGGGGGAGGGGGG + Intergenic
990909236 5:60837299-60837321 TGGTAGGGCGGGGGGGTGGGGGG + Intronic
991426843 5:66500525-66500547 TACTAGGATGTGGTGGAGGGTGG - Intergenic
991559114 5:67930386-67930408 TATTGTGGGGTGGGGGAGGGGGG + Intergenic
991690109 5:69217649-69217671 TAGTAGGGAGAAGGGGTGGGCGG + Intergenic
991898770 5:71435208-71435230 AAGTAGGGAGGGAGGGAGGGAGG - Intergenic
992175270 5:74143689-74143711 AAGTGGCGGGTGGGGGAGGGAGG - Intergenic
992453688 5:76896168-76896190 TAGCAGGGGGTTGGGGAGGACGG - Intronic
992558481 5:77927338-77927360 GTGTAGGGTGTGGGAGAGGGCGG - Intergenic
992849089 5:80785988-80786010 TTGTGGGGTGGGGGGAAGGGGGG + Intronic
993208836 5:84921624-84921646 TTCTAGGGTCTGGAGGAGGGTGG - Intergenic
993232708 5:85257634-85257656 TAGTGTGGGGTGGGGGAAGGGGG - Intergenic
993513990 5:88806535-88806557 TATTTAGTTGTGGGGGAGGGTGG - Intronic
993741882 5:91551489-91551511 TGGAAGGGTGTGGGAGTGGGAGG + Intergenic
993931757 5:93949777-93949799 TAATGGGTTGTAGGGGAGGGAGG - Intronic
994100185 5:95883113-95883135 TAGTATGGGGTGGGGGCAGGGGG + Intergenic
994205685 5:97033068-97033090 TTTTGGGGTGTGGGGGAGAGTGG + Exonic
994261562 5:97665450-97665472 TTGTGGGGTGGGGGGAAGGGGGG - Intergenic
994369831 5:98955437-98955459 TTGTGGGGTGGGGGGGAGGGGGG - Intergenic
994449653 5:99926153-99926175 TTGTGGGGTGGGGGGGAGCGGGG + Intergenic
994526227 5:100908423-100908445 TTGTGGGGTGGGGGGGAGGGGGG - Intergenic
995081842 5:108060720-108060742 TAGGATTGTGTGTGGGAGGGGGG - Intronic
995239307 5:109867898-109867920 TTGTGGGGTCTGGGAGAGGGTGG + Intronic
995972765 5:117992682-117992704 TAGATTGGGGTGGGGGAGGGTGG + Intergenic
996187202 5:120491687-120491709 TAGATGGGTGTGGTGGCGGGTGG - Intronic
996241438 5:121208109-121208131 CTGTCGGGTGGGGGGGAGGGGGG - Intergenic
996444990 5:123537421-123537443 TGGAAGGGTGAGGGGGTGGGAGG + Intronic
997698202 5:135878057-135878079 TTGTAGGGTGGGAGTGAGGGGGG + Intronic
998038445 5:138935936-138935958 ATGGAGGGTGTGGGGGTGGGCGG - Intergenic
998061372 5:139121269-139121291 TATCAGGCTGTGGGGGAGAGGGG - Intronic
998136282 5:139676269-139676291 GAGGAGGGTGGGGAGGAGGGTGG - Intronic
998247509 5:140520776-140520798 TTGTGGGGTGGGGGGGAGGGGGG + Intronic
998352656 5:141511523-141511545 GAGTGGGGTGGGGAGGAGGGAGG - Exonic
998390729 5:141785458-141785480 GAATGGGGAGTGGGGGAGGGGGG + Intergenic
998433405 5:142085848-142085870 TAGCAGGGTGTGGTGAATGGTGG + Intergenic
998451216 5:142235821-142235843 GAGCAGGGAGTGGGGGTGGGGGG + Intergenic
998497501 5:142603396-142603418 GAAGAGGATGTGGGGGAGGGTGG - Intronic
998541411 5:142985650-142985672 TTGTAGGGTGGGGGGGAGGGGGG - Intronic
999129820 5:149273759-149273781 TAGGAGTGTGAAGGGGAGGGGGG - Intronic
999162805 5:149518788-149518810 AAGGGGGTTGTGGGGGAGGGGGG + Intronic
999226655 5:150030907-150030929 TAGGAGGCTGGGGGAGAGGGTGG + Intronic
999466910 5:151815957-151815979 AAATTGGGGGTGGGGGAGGGGGG + Intergenic
999530783 5:152461444-152461466 TTGTAGGGTGGGGATGAGGGAGG - Intergenic
999548115 5:152654104-152654126 TTGTGGGGTGGGGGGGAGGGGGG - Intergenic
999993822 5:157072753-157072775 TAGCAGGGTGTGGTGGCTGGTGG - Intergenic
1000163249 5:158621804-158621826 TGGTAGGGGGTGGGGGTGGTGGG - Intergenic
1001167838 5:169386990-169387012 TCGTAGGGTGGGGGGGATGGGGG + Intergenic
1001350543 5:170959230-170959252 TAGCAGGGTTTGGGAGAGAGAGG - Intronic
1001420018 5:171579141-171579163 TAGTGAGGTGTGGGAGTGGGTGG + Intergenic
1001578431 5:172780771-172780793 TAGCTGGGTGTGGGGACGGGGGG + Intergenic
1001739771 5:174042920-174042942 TAGTAGGGAGTGGGGAAGAAGGG - Intergenic
1001919515 5:175589037-175589059 AAGAAGGGTGAGAGGGAGGGAGG + Intergenic
1001961898 5:175884554-175884576 TATTAGGGTGAGGGTAAGGGTGG - Intergenic
1002043490 5:176530106-176530128 TAGTAGGGTGGTGGGGGTGGGGG + Exonic
1002080414 5:176734063-176734085 CAGAAGGGTGTGGGGGCGGGAGG + Intergenic
1002519403 5:179782979-179783001 TTTCAGGGTGTGGGGGAGGGTGG - Intronic
1002613470 5:180436212-180436234 CTGTGGGGTGTGGGGAAGGGAGG + Intergenic
1002937796 6:1688174-1688196 TTGTGGGGTGTGAGAGAGGGAGG + Intronic
1003086636 6:3065526-3065548 GAGATGGGTGTGGGGGAGGAGGG + Intronic
1003119972 6:3311220-3311242 GAGCAGGGACTGGGGGAGGGAGG + Intronic
1003551617 6:7106953-7106975 TTGTGGGGTGTGGGTAAGGGAGG + Intergenic
1003593183 6:7452969-7452991 CAGTAGTGTCTGGGGGTGGGGGG - Intergenic
1003708775 6:8565572-8565594 GAGTTGGGTGTGGGGAAGGAGGG + Intergenic
1003794671 6:9587535-9587557 TTGTAGGATGTGGGAGAGGTGGG + Intergenic
1003834777 6:10059095-10059117 TTTTAGGTAGTGGGGGAGGGTGG - Intronic
1004078342 6:12366094-12366116 TAGTAGGGTGTGGAGCCGCGTGG - Intergenic
1004248567 6:14003147-14003169 CAGCAGGATGTGGGGGGGGGGGG + Intergenic
1004265702 6:14146670-14146692 TAGCAGAGTGTGGGGGAGGGAGG - Intergenic
1004407541 6:15348235-15348257 TAGCCGGGTGTGGTGGCGGGCGG - Intronic
1004502991 6:16225715-16225737 TCGTGGGGTGGGGGGCAGGGGGG + Intergenic
1004562186 6:16761239-16761261 GAGAAGGGAATGGGGGAGGGGGG + Intronic
1004717712 6:18234184-18234206 TTGTGGGGTGGGGGGGACGGGGG + Intronic
1004724443 6:18297474-18297496 TAGAAGGGTGTGGGATGGGGTGG + Intergenic
1004868046 6:19873586-19873608 GAGTAGAGGGTGGTGGAGGGAGG + Intergenic
1004924307 6:20403216-20403238 GAGTCGGGCGTGGGGGAGGTGGG + Intronic
1004933756 6:20487671-20487693 TAGTGGGGCTTGGGGGAGAGGGG - Intronic
1004990868 6:21137017-21137039 TAGTAAGGGGTGGGGGCGAGGGG - Intronic
1005177642 6:23064813-23064835 TTGTGGGGTGGGGGGGAGGGGGG + Intergenic
1005509037 6:26495661-26495683 GTGTAGGGTGTGGGGTTGGGGGG - Intergenic
1005690399 6:28299330-28299352 AAGTGGGGTGGGGGTGAGGGAGG - Intronic
1006059066 6:31405696-31405718 TAGTGGGGAGTGGGGGAGCAGGG - Intronic
1006071552 6:31500580-31500602 TAGTGGGGAGTGGGGGAGTGCGG - Intronic
1006268530 6:32945664-32945686 TAGGAGGGTGTGTGTGTGGGCGG - Intronic
1006415556 6:33901754-33901776 AGGTAGGCTGTCGGGGAGGGAGG + Intergenic
1006548803 6:34803027-34803049 TAGCTGGGTGTGGGGCATGGTGG + Intronic
1006588727 6:35138588-35138610 TAGTTGGGTGGGGGGTTGGGGGG + Intronic
1006589430 6:35143137-35143159 GAGAGGGGGGTGGGGGAGGGTGG + Intronic
1006739586 6:36297806-36297828 AAGAAGGGAGTGGGGGAGGAGGG - Intronic
1006806355 6:36792179-36792201 TGGTAGGGGGCGGGGGAGGATGG - Intronic
1006986450 6:38178736-38178758 CAGCAGGGTGTGGGGGGGAGGGG + Intronic
1007012179 6:38428392-38428414 TAGTTGGGAGTGGGTGGGGGTGG - Intronic
1007081510 6:39108413-39108435 TAGATGGGTGTGGGGGTGGGGGG + Intronic
1007277806 6:40688604-40688626 AAGGAGGGGGCGGGGGAGGGAGG - Intergenic
1007342133 6:41198046-41198068 TAGTGGAGTGTGGGGCAGGAGGG + Intronic
1007348317 6:41249691-41249713 TAGTGGAGTGTGGGGCAGGGAGG - Intergenic
1007393127 6:41561945-41561967 TACAAGGGTGTGGGGTATGGAGG - Intronic
1007433200 6:41788288-41788310 TAGCAGGGCGTGGTGGCGGGCGG - Intronic
1007533017 6:42559734-42559756 TAGTTGGGTGTGGTGGCAGGTGG + Intergenic
1007753791 6:44085847-44085869 AAGAAGGGTGTGAGGAAGGGAGG + Intergenic
1007838336 6:44695262-44695284 TTGTGGGGTGGGGGGGAGAGGGG - Intergenic
1008065769 6:47046349-47046371 TAGTGGGCAGTGGGGGAGTGGGG - Intergenic
1008376767 6:50801075-50801097 GGGTAGGATGTGGGGGAAGGGGG - Intergenic
1008503233 6:52204418-52204440 TTGTGGGGTGGGGGGGAGGGGGG - Intergenic
1008648594 6:53541603-53541625 TAGTAGGGTGGGGGGGCGGTGGG + Intronic
1008783295 6:55134637-55134659 TACCAGGGTCTGGGAGAGGGAGG - Intronic
1008904648 6:56662794-56662816 TAGTTGGGCATGGGGGCGGGGGG + Intronic
1008967717 6:57330478-57330500 TAGCAGGGTGTGGTGGCCGGCGG - Intronic
1009499753 6:64395629-64395651 TTGTCGGGTTGGGGGGAGGGGGG + Intronic
1009522797 6:64705824-64705846 TTGTGGGGTGGGAGGGAGGGGGG + Intronic
1009805561 6:68597868-68597890 TTGTGGGGTGTGGGGGAGTGGGG + Intergenic
1009869770 6:69439685-69439707 TTGTGGGGTGGGTGGGAGGGGGG - Intergenic
1009894674 6:69733730-69733752 TAGTTGGGGTTGGGGGAGTGTGG - Intronic
1010393473 6:75363190-75363212 TGGGATGGGGTGGGGGAGGGAGG + Intronic
1010608963 6:77928982-77929004 TTGTGGGGTGTGGGAGGGGGAGG + Intergenic
1010692472 6:78926677-78926699 TGGGAGGGTGTCGGGGAGGTGGG - Intronic
1010781226 6:79947633-79947655 TACTAGGGAGGGAGGGAGGGAGG - Intergenic
1010851148 6:80779948-80779970 TTGTGGGGTGGGGGGGAGTGGGG - Intergenic
1010877296 6:81123392-81123414 TTGTGGGGTGGGGGGGAGGGGGG - Intergenic
1011017794 6:82777731-82777753 TAGGAGGGAGAGAGGGAGGGAGG + Intergenic
1011354233 6:86457571-86457593 TGGTAGGGTGTGATGGAGGCAGG + Intergenic
1011605569 6:89101574-89101596 TAGCTGGGTGTGGTGGCGGGAGG + Intronic
1012041443 6:94209888-94209910 TAGCCGGGTGTGGTGGTGGGAGG - Intergenic
1012515493 6:100054302-100054324 TACTAGAGGGTTGGGGAGGGAGG - Intergenic
1012549994 6:100457320-100457342 TTGTAGGCAATGGGGGAGGGTGG + Intronic
1012780907 6:103556716-103556738 TTGTGGGGTGGGGGGAAGGGGGG - Intergenic
1012807895 6:103918026-103918048 TTGTGGGGTGGGGGGGAGGGGGG + Intergenic
1013042949 6:106454359-106454381 TAGTGGGGTGTGTGTGTGGGTGG - Intergenic
1013223520 6:108101660-108101682 AAAAAGGGTGTGGGGGCGGGTGG - Intronic
1013257030 6:108397598-108397620 TAGTGGGGGATGGGGGAAGGTGG - Intronic
1013327618 6:109063283-109063305 TAGGAGGGTGGGGTGGTGGGAGG + Intronic
1013474880 6:110497904-110497926 TAGCAGAGAGTGGAGGAGGGTGG + Intergenic
1013606383 6:111752854-111752876 TAGGAGGGTGGTGGTGAGGGTGG + Intronic
1013655584 6:112243271-112243293 TGGTAGGGGGTGGGGAGGGGTGG - Intronic
1013896349 6:115093166-115093188 TGTTAGGGGGTGGGGGAGAGAGG - Intergenic
1014298685 6:119652721-119652743 TGGCAGGGTGTGGGGGTCGGTGG + Intergenic
1014828697 6:126076097-126076119 TAGTAGGTTGTGGGGGGTTGGGG + Intergenic
1014973445 6:127848063-127848085 TTGTGGGGTGGGGGGGAGGGGGG - Intronic
1015080521 6:129219824-129219846 TTGTGGGGTGGGGGGGAGGGGGG + Intronic
1015126694 6:129763152-129763174 GACTAGGGTGTGGGGGAGATGGG - Intergenic
1015711681 6:136148438-136148460 GAGGAGGGTGGGAGGGAGGGAGG + Intronic
1015942929 6:138469957-138469979 AAGAAGGGAGTGGGGGAGGCAGG + Intronic
1015945161 6:138492227-138492249 CAGGAGGGAGTGGGGGAGTGAGG + Intronic
1015989106 6:138917108-138917130 AAGAAGGGTGTGGGATAGGGTGG - Intronic
1016879496 6:148897111-148897133 AAATAGGGTGTGGGGTGGGGTGG - Intronic
1016934078 6:149436107-149436129 CAGTAGGGGCTGGGGGAGGCCGG + Intergenic
1017033449 6:150245117-150245139 GAGTAGGGTGTGGCGGGGAGGGG - Intronic
1017112115 6:150941753-150941775 GTGTGGGGTGTGGTGGAGGGTGG + Intronic
1017145374 6:151229980-151230002 TTGTGGGGTGGGGGTGAGGGGGG - Intergenic
1017631095 6:156397182-156397204 TGGTCGGGGGTGGGGGTGGGGGG - Intergenic
1017744210 6:157432378-157432400 TCGGAGGCTGTGGGGGAGAGTGG + Intronic
1017777402 6:157690957-157690979 GAGAAGGGTGTGGGGGTGGAAGG - Intergenic
1017827094 6:158089695-158089717 TTGCAGGGTGTGGTGGAGGCTGG + Intronic
1017877820 6:158538119-158538141 GAGTAGGGGGCGGGGGACGGGGG - Intronic
1018143032 6:160858804-160858826 TGGCAGGGTGGGGGGGGGGGCGG - Intergenic
1018410468 6:163540237-163540259 TAGCAGGGTGGGGAGTAGGGAGG + Intronic
1019009876 6:168835781-168835803 GAGAAGGATGTGAGGGAGGGAGG - Intergenic
1019265105 7:110867-110889 GAGAAGGGGGTGGGGGTGGGGGG - Intergenic
1019498322 7:1351882-1351904 TAGTAGGGGGTGGGGGCGAGGGG + Intergenic
1019588148 7:1815736-1815758 TAGCAGGGTGGGCGGGAGGAGGG - Intergenic
1019874156 7:3793981-3794003 TACTAGGATGTGGGGGTTGGAGG - Intronic
1019874408 7:3796513-3796535 TTGTAGGCTGGGGGGGAGAGGGG - Intronic
1020163103 7:5787263-5787285 TAGGTGGGTGTGGTGGTGGGGGG - Intergenic
1020740180 7:12006242-12006264 TAGCAGTATGTTGGGGAGGGAGG - Intergenic
1020968331 7:14901603-14901625 CAGTGGGGGGTGGGGGGGGGTGG - Intronic
1021493309 7:21244625-21244647 GAGTAGGGTGAGAGGGAGGAAGG - Intergenic
1022310700 7:29194179-29194201 AGGGAGGGTGTGGGGGAAGGTGG - Intronic
1022319427 7:29274938-29274960 GAGGAGGGTGTTGGGCAGGGTGG + Intronic
1022338111 7:29442329-29442351 TAGTGGTGTATGTGGGAGGGAGG + Intronic
1022340979 7:29468142-29468164 TAGTCGGGCGGGGGGGGGGGGGG - Intronic
1022729234 7:33007123-33007145 TAGAGGGGTGTGGGCGAGGCTGG + Intergenic
1022846257 7:34213142-34213164 TAGTAGGGTGGATGGGTGGGGGG + Intergenic
1023528925 7:41133576-41133598 AAGAAGGGGGTGGGGGCGGGGGG + Intergenic
1023834974 7:44062623-44062645 ACGTATGGAGTGGGGGAGGGTGG + Intronic
1023837946 7:44079531-44079553 TAGCAGGGTGAGTGGGTGGGTGG - Intronic
1023863243 7:44227502-44227524 GAGGAGGGTGTGGGGGACAGAGG + Intronic
1023863327 7:44227746-44227768 GAGGAGGGTGTGGGGGACAGAGG + Intronic
1023863340 7:44227785-44227807 GAGGAGGGTGTGGGGGACAGAGG + Intronic
1023867991 7:44247880-44247902 TAGCTGGGTGTGGTGGTGGGCGG + Intronic
1024300339 7:47882676-47882698 TTGGAGGGTGGGAGGGAGGGAGG + Intronic
1024452208 7:49560245-49560267 TTGTGGGTTGGGGGGGAGGGGGG + Intergenic
1025044421 7:55680857-55680879 TAGAGGGGTGTGGGCGAGGCTGG - Intergenic
1025065940 7:55856146-55856168 TACTAGAGGGTGAGGGAGGGAGG - Intronic
1025310208 7:57926790-57926812 TTGTAGAGTGGGGGTGAGGGGGG - Intergenic
1025886273 7:65597043-65597065 TTGTGGGGTGGGGGGGAGGGGGG - Intergenic
1026089506 7:67287678-67287700 GAGCAGGGGTTGGGGGAGGGGGG + Intergenic
1026527564 7:71168424-71168446 TAGCTGGGTGTGGTGGCGGGCGG + Intronic
1026693446 7:72570456-72570478 TAGTAGAGATGGGGGGAGGGGGG - Intronic
1027222666 7:76223925-76223947 GAGAAGGGAGAGGGGGAGGGGGG - Intronic
1027267885 7:76504079-76504101 TCGTAGGGCCTGGGGCAGGGTGG + Intronic
1027299959 7:76821831-76821853 TAGGTGGGTGGGGGTGAGGGTGG + Intergenic
1027319696 7:77003941-77003963 TCGTAGGGCCTGGGGCAGGGTGG + Intergenic
1027374896 7:77538538-77538560 AAGTAGGGGGTGGCGGAGGCGGG - Intronic
1027534411 7:79379105-79379127 TTGTGGGGTGGGGGGGAGGAGGG - Intronic
1027967943 7:85038043-85038065 TTGTGGGGTGGGGGGGAGGGGGG + Intronic
1028022039 7:85789269-85789291 TCCTAGGGGGTGAGGGAGGGAGG + Intergenic
1028087333 7:86652474-86652496 TAGTTGGGCGTGGTGGCGGGCGG - Intronic
1028224185 7:88230961-88230983 TAGAAGGGGGTAGGTGAGGGTGG - Intergenic
1028283902 7:88970349-88970371 TAGAGGGTTGTGGGGGTGGGGGG - Intronic
1028374011 7:90126050-90126072 TGGTGGGGGGTGGGGGTGGGGGG + Intergenic
1028984447 7:96998588-96998610 TGGTGAGGTTTGGGGGAGGGGGG + Intergenic
1029033551 7:97494258-97494280 TTGTTGTGTGTGGGGGTGGGTGG + Intergenic
1029045984 7:97629228-97629250 TTGTGGGGTGGGGGGGAGGGGGG + Intergenic
1029097294 7:98098126-98098148 AAGTATAGTGTGGGGGTGGGGGG - Intergenic
1029181506 7:98705283-98705305 TAGTAGGGGTTGGGGGAGGCGGG - Intergenic
1029232033 7:99078502-99078524 GAGGAGGGTGCAGGGGAGGGGGG - Intronic
1029406748 7:100379740-100379762 TAGTAGACTCTGGGAGAGGGTGG - Intronic
1029440904 7:100586146-100586168 AAGGAGGGGGTGGGGGAAGGAGG - Exonic
1029468225 7:100739411-100739433 GAGTAGGGTGTGGTAGCGGGGGG + Intronic
1029909368 7:104128669-104128691 TTGTGGGGTGGGGGGGAGGGGGG - Intronic
1030183628 7:106737175-106737197 TTGTGGGGAGTGGGGGAGAGTGG - Intergenic
1030203361 7:106928343-106928365 CAGGAGGGAGTGAGGGAGGGAGG + Intergenic
1030457016 7:109788191-109788213 TAGTGCGGTGTGTGGGTGGGTGG + Intergenic
1030491240 7:110237516-110237538 TATTGGGGGGGGGGGGAGGGGGG + Intergenic
1030590157 7:111470721-111470743 TTGTGGGGTGGGGGGGAGGGGGG + Intronic
1030775061 7:113524088-113524110 TTGTGGGGTGTGGGGAGGGGGGG + Intergenic
1030872511 7:114774577-114774599 TAGTGGGGGTTGGGGAAGGGAGG + Intergenic
1030947261 7:115738969-115738991 TTGTGGGGTGGGGGGGAGAGGGG + Intergenic
1030991549 7:116307152-116307174 TAGAAGGGTGATGGGGTGGGAGG + Intronic
1031171901 7:118302765-118302787 TGGTGGGGTGTGGGGGAGGGGGG - Intergenic
1031556767 7:123186675-123186697 GGGTAGGTTGTGGGGGAGGAAGG - Intronic
1031737590 7:125385702-125385724 TTGTGGGGTGGGGGGGAGCGGGG + Intergenic
1031760841 7:125711253-125711275 TCGTGTGGTGGGGGGGAGGGGGG + Intergenic
1032002741 7:128275890-128275912 TGGGAGAGTGTGGGGGAGAGAGG + Intergenic
1032281479 7:130506312-130506334 CAGAGGGGTGGGGGGGAGGGGGG - Exonic
1032357759 7:131226026-131226048 AAGTAGGGAGGGAGGGAGGGGGG - Intronic
1032502469 7:132410197-132410219 TAGCATGGGCTGGGGGAGGGGGG - Intronic
1032621399 7:133537299-133537321 TAGTCAGGTGTGGTGGGGGGGGG - Intronic
1032701524 7:134384048-134384070 TAGTGGGGTGGGTGGCAGGGGGG - Intergenic
1032869584 7:135969080-135969102 TTGTGGGGTGGGGGGGGGGGAGG + Intronic
1032916449 7:136495407-136495429 TAGTGGGGGGGGGGGGGGGGTGG - Intergenic
1033088193 7:138361620-138361642 TAGAAAGGTGTGGGGAAGTGGGG - Intergenic
1033120721 7:138664755-138664777 CAGCAGCGTGCGGGGGAGGGGGG - Intronic
1033485165 7:141781828-141781850 AAGTAGGGAGGGAGGGAGGGAGG - Intronic
1033786768 7:144740951-144740973 TTGTAGGGTGGGAGGGAGAGAGG + Intronic
1033801809 7:144910650-144910672 CAGAGGGGAGTGGGGGAGGGAGG - Intergenic
1033908409 7:146235255-146235277 TGGTGGGTTTTGGGGGAGGGTGG + Intronic
1035011292 7:155717524-155717546 GGGTTGGGTGTGGGGGCGGGGGG + Intronic
1035709887 8:1705185-1705207 GAGTAGGGAGTGGGGGAGGTGGG + Exonic
1035779655 8:2217344-2217366 TGGTGGGGTGTGGGTGAGGGTGG + Intergenic
1035979070 8:4348605-4348627 GTGTTGGGGGTGGGGGAGGGAGG + Intronic
1036213764 8:6863150-6863172 TGGTGGGGAGTGGGGGAGGCTGG + Intergenic
1036739839 8:11350080-11350102 TATTGGGGTGTGGCGGTGGGGGG - Intergenic
1037029301 8:14083305-14083327 TAGCAGGATGTGGGGGTGGGAGG + Intergenic
1037789484 8:21924443-21924465 TAGTGGGGTGGGGGGGGGAGGGG - Intronic
1037957307 8:23069551-23069573 AGGTAGGGGGAGGGGGAGGGAGG - Intergenic
1038022847 8:23564462-23564484 TGGGGGGGAGTGGGGGAGGGAGG + Intronic
1038034551 8:23676084-23676106 TAGTCAGGTGTGGTGGAGGAAGG - Intergenic
1038141402 8:24849309-24849331 TCATGGGGTGGGGGGGAGGGGGG - Intergenic
1038412104 8:27366859-27366881 GGAGAGGGTGTGGGGGAGGGAGG + Intronic
1038691094 8:29764333-29764355 TTGTGGGGTGGGGGGGAGGGGGG + Intergenic
1038764410 8:30414098-30414120 GAGGAGGGGGTGGGGGAGGAGGG - Intronic
1038774512 8:30516232-30516254 TAGCCGGCTGTGGTGGAGGGTGG + Intronic
1039042581 8:33422394-33422416 TAGCCGGGTGTGGTGGTGGGGGG + Intronic
1039132054 8:34276153-34276175 TAGTAGGTTATAGGGGAGGAGGG - Intergenic
1039217626 8:35290477-35290499 GGGTAGGGGGTTGGGGAGGGAGG + Intronic
1039411574 8:37359585-37359607 TGGAAGGGTGTGGTGGATGGAGG - Intergenic
1039608702 8:38902210-38902232 AAGAAGGGTGTGGGGGGGGGTGG + Intronic
1039755225 8:40515726-40515748 TTGTAGGGTGGTGGGGAGTGGGG - Intergenic
1039906760 8:41792009-41792031 TATTAGCGTGTAGGGGAAGGTGG - Intronic
1039957987 8:42221913-42221935 TAGTGGGGTGAGGAGGGGGGTGG - Intergenic
1039981486 8:42412612-42412634 TGGTAGGGAGTGGGGCAAGGAGG - Intergenic
1040071919 8:43195606-43195628 AAGGAGGGTGTGGAGGAGGATGG + Intronic
1040363268 8:46687575-46687597 TACTAGAGGGTGAGGGAGGGAGG + Intergenic
1040369050 8:46750007-46750029 TTGTAGGGTGGGGGGAGGGGGGG + Intergenic
1040383890 8:46899950-46899972 GTGTGGGGTGTGGGGGATGGGGG + Intergenic
1040946579 8:52891582-52891604 AAATAGGGTGTGGGGGAGGAGGG - Intergenic
1040985480 8:53289775-53289797 TACTAGAGTGGGGGGTAGGGAGG + Intergenic
1041481375 8:58323377-58323399 TGTTGGGGGGTGGGGGAGGGGGG + Intergenic
1041829139 8:62133001-62133023 CAGGAGGCTGTGGTGGAGGGAGG - Intergenic
1042049508 8:64688375-64688397 AAGGAGGGTGGGAGGGAGGGAGG - Intronic
1042096130 8:65217837-65217859 TCGTCGGGAGTGGGGGTGGGGGG - Intergenic
1042128872 8:65566623-65566645 TACTAGGGTGCAGGGGAGAGGGG - Intergenic
1042228333 8:66532722-66532744 TAATAGGGTGTGGAGGGGTGAGG - Intergenic
1042334770 8:67618440-67618462 TACTGGGGTGTGAGGGAGGGAGG + Intronic
1042484401 8:69334687-69334709 TAGCAGGGTGCGGGAGAGGCAGG + Intergenic
1043510156 8:80943162-80943184 TTGTGGGATGTGAGGGAGGGAGG - Intergenic
1043603890 8:81975831-81975853 TTGTAGGGGGTGGGGGTCGGGGG - Intergenic
1043805657 8:84669481-84669503 GAGTGGGGGGGGGGGGAGGGGGG - Intronic
1043944632 8:86235667-86235689 TAGCTGGGTGTGGTGGAGCGTGG - Intronic
1044270769 8:90240448-90240470 TTGTGGGGTGGGGGGGAGAGGGG + Intergenic
1044557983 8:93585438-93585460 TGGAAGGGTGTGTGGGTGGGAGG + Intergenic
1044591794 8:93919608-93919630 TATTTGTGTGGGGGGGAGGGAGG - Intronic
1044607848 8:94062585-94062607 TGACAGGTTGTGGGGGAGGGAGG - Intergenic
1044869731 8:96607112-96607134 TGGGAGGGTGGGGGGGATGGAGG - Intronic
1045154995 8:99458061-99458083 TTGTGGGGTTGGGGGGAGGGGGG - Intronic
1045194487 8:99916379-99916401 TACCAGGGTCTGGGGAAGGGTGG - Intergenic
1045308639 8:100981317-100981339 TAATATTTTGTGGGGGAGGGTGG - Intergenic
1045323104 8:101096764-101096786 GAGGAGTGTGTGGGGGTGGGGGG + Intergenic
1045491296 8:102671320-102671342 GAGAAGGGAGTGGAGGAGGGTGG - Intergenic
1045753820 8:105517746-105517768 TAGTTGGGTGTGGGGGCATGTGG + Intronic
1045974065 8:108111397-108111419 TTGTGGGGTGGGGGGGATGGGGG - Intergenic
1045985595 8:108246274-108246296 TAAGGGGGTGTGGGGGGGGGGGG + Intronic
1045986157 8:108251770-108251792 AAGGAGGATGTGGGGGTGGGAGG + Intronic
1046302850 8:112320634-112320656 TCGTGGGGTGGAGGGGAGGGGGG - Intronic
1047074811 8:121389277-121389299 TACTGGGGTGTGTGGGAGAGTGG - Intergenic
1047712107 8:127562836-127562858 TTGTGGGGTGGGGTGGAGGGGGG - Intergenic
1047767037 8:127998618-127998640 AAGGAGGGAGTGAGGGAGGGAGG - Intergenic
1047870656 8:129078084-129078106 GTGGAGGGAGTGGGGGAGGGTGG + Intergenic
1048222600 8:132555635-132555657 TAGCCGGGTGTGGTGGTGGGCGG + Intergenic
1048227583 8:132603590-132603612 TAGTGGGGGGTGGGGGTGTGGGG + Intronic
1048343272 8:133556801-133556823 AAATATGGTGTGGTGGAGGGGGG + Intronic
1048490196 8:134885120-134885142 CAGCAGGGTGTGGGGTAGGAGGG + Intergenic
1048695800 8:137026389-137026411 TTGTGGGGTTGGGGGGAGGGGGG + Intergenic
1048837789 8:138537628-138537650 TTGTGGGGTGGGGGGGAGGGGGG + Intergenic
1048873303 8:138816334-138816356 TCCCAGGGTGTGGGGCAGGGAGG - Intronic
1048919788 8:139217916-139217938 GTGTGGGGTGTGGGGGAGTGTGG - Intergenic
1049419599 8:142510918-142510940 GAGGAGGGTCTGGGGGCGGGCGG - Exonic
1049466553 8:142753540-142753562 GTGTAGGGTGTGGGGGTTGGGGG + Intergenic
1049541605 8:143211492-143211514 TAGACAGGTGTGGGGGAGGCGGG + Intergenic
1049989245 9:976596-976618 GAGGAGGGGTTGGGGGAGGGCGG + Intergenic
1050015595 9:1229735-1229757 TGGTGGGGTGGGGGGGATGGGGG + Intergenic
1050091230 9:2017301-2017323 AAGTAGGGTGGAGGGGTGGGAGG + Intronic
1050221509 9:3396184-3396206 TTGTGGGGTGGAGGGGAGGGGGG - Intronic
1050250071 9:3734497-3734519 CAGCAGGATGTGGGGGGGGGTGG + Intergenic
1050289998 9:4144046-4144068 CAGCATGGTTTGGGGGAGGGTGG + Intronic
1050377545 9:4988153-4988175 TAAAAGGGAGTGGGGAAGGGTGG - Intronic
1050719382 9:8568318-8568340 TAGTAGAGAGGGAGGGAGGGAGG - Intronic
1051058255 9:13014209-13014231 TAGTAGGATGGGGTGGAGAGTGG - Intergenic
1051673059 9:19531697-19531719 TAGTAGGATTTGGGGGGTGGGGG - Intronic
1051724453 9:20074604-20074626 AAGAAGGGAGTGAGGGAGGGAGG + Intergenic
1052234614 9:26195021-26195043 TTGTAGGGGTTGTGGGAGGGAGG - Intergenic
1052408497 9:28092543-28092565 TTGTGCGGTGGGGGGGAGGGGGG + Intronic
1052417837 9:28201222-28201244 TGGTGGGGTTGGGGGGAGGGGGG - Intronic
1052771321 9:32693549-32693571 TAGCAGGGTGCTGGGGAGGAAGG + Intergenic
1052868005 9:33477596-33477618 AAGGAGGGTGGGAGGGAGGGAGG - Intergenic
1053130158 9:35610051-35610073 TAGAATGGGGTGGGGGAGGAGGG - Exonic
1053144037 9:35699853-35699875 AAGTAGAGGGTGGGGTAGGGAGG + Intronic
1053316823 9:37059155-37059177 TTGTTGGGGGTGGGGGAGGAGGG - Intergenic
1053471032 9:38346332-38346354 GAGTAGGGTGAGGTGGAGGCAGG - Intergenic
1053562325 9:39209614-39209636 GAGAGGGGAGTGGGGGAGGGAGG - Intronic
1053781981 9:41619185-41619207 AAGTTTGCTGTGGGGGAGGGGGG - Intergenic
1053786294 9:41655077-41655099 CAGCAGGCTGTGGGGGTGGGGGG + Intergenic
1054158759 9:61659122-61659144 CAGCAGGCTGTGGGGGTGGGGGG - Intergenic
1054169932 9:61829339-61829361 AAGTTTGCTGTGGGGGAGGGGGG - Intergenic
1054175007 9:61869021-61869043 CAGCAGGCTGTGGGGGTGGGGGG + Intergenic
1054478533 9:65590127-65590149 CAGCAGGCTGTGGGGGTGGGGGG - Intergenic
1054490134 9:65767686-65767708 GGGTGGGGTGTGGGGGGGGGAGG + Intergenic
1054602429 9:67139848-67139870 GAGAGGGGAGTGGGGGAGGGAGG + Intergenic
1054662530 9:67711772-67711794 CAGCAGGCTGTGGGGGTGGGGGG - Intergenic
1054667606 9:67751476-67751498 AAGTTTGCTGTGGGGGAGGGGGG + Intergenic
1054706944 9:68472339-68472361 CAGGAGGGGGTTGGGGAGGGTGG - Intronic
1054938522 9:70714635-70714657 TCGTGGGGTGGGGGGGAGGAGGG + Intronic
1054940213 9:70732628-70732650 TCGTGGGGTGGGGGGGAGGAGGG + Intronic
1055105997 9:72513666-72513688 TTGTGGGGTGTGGGGAGGGGGGG + Intergenic
1055803396 9:80066277-80066299 TAGGGTGGGGTGGGGGAGGGGGG - Intergenic
1055907572 9:81311776-81311798 TAGTAGGGTTGGGCGGGGGGAGG + Intergenic
1055947122 9:81701732-81701754 TTGTAGGGTGGGGGGAAGGGGGG - Intergenic
1056246588 9:84701522-84701544 GCTTAGGGGGTGGGGGAGGGAGG + Intronic
1056275342 9:84989181-84989203 TAGTAGTTTGTGGGGTGGGGTGG - Intronic
1056583598 9:87913797-87913819 TAGTAGGGCGTGGTGGTGGTGGG + Intergenic
1056719390 9:89059535-89059557 GTGTAGGATGTGGTGGAGGGTGG + Intronic
1057203319 9:93155447-93155469 TGCTAGGGCCTGGGGGAGGGAGG - Intergenic
1057533839 9:95878650-95878672 TTGTGGGGTGGGGGGAAGGGGGG - Intronic
1057638512 9:96795029-96795051 TAGTATGGCATGGGGGTGGGTGG + Intergenic
1057705440 9:97392041-97392063 TGTTAGGGGGTGGGGGTGGGGGG + Intergenic
1058051429 9:100410844-100410866 GAAAAGGGAGTGGGGGAGGGAGG - Intergenic
1058811617 9:108645027-108645049 TGGTGGGGTGTGGGGCAGAGTGG - Intergenic
1058857375 9:109076377-109076399 CTGTGGGGTGGGGGGGAGGGGGG + Intronic
1058868885 9:109185742-109185764 AAGTAGGCTGTGGGTGAGGCTGG - Intronic
1058977761 9:110140682-110140704 TACTGGAGTGTGGGGGAAGGAGG - Intronic
1059022677 9:110593675-110593697 TGGGAGGGTGGGGGGGTGGGAGG - Intergenic
1059386441 9:113968626-113968648 TATTTGGGTGTGGGGGGAGGGGG - Intronic
1059641305 9:116219549-116219571 GAGTGGGGGGTGAGGGAGGGAGG + Intronic
1059701049 9:116775660-116775682 AAGGAGGGTGAGAGGGAGGGAGG + Intronic
1059996779 9:119918318-119918340 GAGCAGGGTGTGGGGTAGGAGGG - Intergenic
1060283265 9:122227950-122227972 GAGTGGGGTGGGGGGGCGGGTGG - Intronic
1060610456 9:124959679-124959701 TTGTGGGGTGGGGGGGATGGGGG - Intronic
1060643298 9:125257310-125257332 TGGTAGGGGGTGGAGGAGGTCGG - Intergenic
1060693724 9:125688282-125688304 TAGCAGGGTGTGGTGGTGGGTGG - Intronic
1060980854 9:127790932-127790954 TAGCTGGGTGTGGTGGTGGGTGG - Intergenic
1061041666 9:128144377-128144399 GAGTTGGGTGAGGGGAAGGGAGG - Intergenic
1061187579 9:129063633-129063655 TAGCAGGGGGTGGGGTGGGGGGG + Intronic
1061496474 9:130977732-130977754 TTGTAGGGAGTAGTGGAGGGAGG + Intergenic
1061532761 9:131227977-131227999 TAGAAGGGCGGGGGGGAGGGGGG + Intronic
1061779599 9:132987795-132987817 TAGTGGTGTGTGGTAGAGGGTGG + Intronic
1061839201 9:133347898-133347920 TATGAGGGTGTGGTGGGGGGTGG - Intronic
1061847187 9:133394419-133394441 ATGTGGGGTGTGGGGGAGGGAGG - Intronic
1062116033 9:134809333-134809355 CAGACGGGTGTGGGGGAGGGTGG + Intronic
1062279934 9:135747337-135747359 TGGTAGGGAGGCGGGGAGGGTGG + Intronic
1062282165 9:135756998-135757020 TAGGAGAGGGTGGGGGAGGTGGG - Intronic
1062326276 9:136014034-136014056 CAGATGGGTGAGGGGGAGGGGGG + Intronic
1062349245 9:136131145-136131167 TAGTAGGGAATGGGGCAGGTGGG + Intergenic
1062708794 9:137960370-137960392 CGGTGGGGTGTGGGGGAGGTTGG + Intronic
1203435870 Un_GL000195v1:136716-136738 TAGTAGGATGTGTTGGCGGGTGG + Intergenic
1185525037 X:771844-771866 TGGCAGGGGGTGGGGGAGAGGGG - Intergenic
1185642464 X:1596445-1596467 TAGGAGGGTGGGAGGGATGGAGG - Intronic
1185642479 X:1596492-1596514 TAGGAGGGTGGGAGGGATGGAGG - Intronic
1185642493 X:1596539-1596561 TAGGAGGGTGGGAGGGATGGAGG - Intronic
1185642508 X:1596586-1596608 TAGGAGGGTGGGAGGGATGGAGG - Intronic
1185642523 X:1596633-1596655 TAGGAGGGTGGGAGGGATGGAGG - Intronic
1185642538 X:1596680-1596702 TAGGAGGGTGGGAGGGATGGAGG - Intronic
1186301556 X:8204950-8204972 GAGCAGGGGGTGGGGGATGGTGG + Intergenic
1186431675 X:9510379-9510401 AAGTTGGGTGGGGAGGAGGGGGG + Intronic
1186568983 X:10694594-10694616 TAGTTGGGTGGGAGGGATGGTGG + Intronic
1186575704 X:10763309-10763331 TTGTGGGGTGGGGGGAAGGGGGG - Intronic
1186604554 X:11076940-11076962 TAGATGGGGGTGGGGGAGGTGGG - Intergenic
1186771408 X:12821435-12821457 TATCAGGGTCTGGGGGTGGGGGG + Intronic
1186892424 X:13972178-13972200 TTGTAGGGTGGGGAGGGGGGAGG - Intergenic
1187575346 X:20547842-20547864 TAGGAGGGAGGGAGGGAGGGAGG + Intergenic
1187767397 X:22657984-22658006 TAGAAGGGTGGGTGGGAAGGTGG + Intergenic
1187778175 X:22787466-22787488 TACTAGAGGGTGGAGGAGGGGGG + Intergenic
1188260202 X:28015073-28015095 GAGGAGGGTGTGGGGGTTGGGGG + Intergenic
1188520591 X:31033653-31033675 TAGCAGGGTGTGAGGTTGGGAGG + Intergenic
1188760161 X:34017799-34017821 TTGTGGGGTGGGGGGGAGGGGGG + Intergenic
1188862212 X:35271336-35271358 TTGTGGGGTTGGGGGGAGGGGGG + Intergenic
1189422353 X:40867345-40867367 TATTAAGGTGTTGGGGAAGGAGG + Intergenic
1190055933 X:47181161-47181183 CAGGAAGGTGTGGGGGTGGGGGG - Intronic
1190119574 X:47649475-47649497 TACAGGGGTGTGGGGGAGGAAGG + Intronic
1190259648 X:48789960-48789982 TAGAAGAGTCTGGGTGAGGGTGG - Intronic
1190275462 X:48896547-48896569 CAGTTGGGTGGGGTGGAGGGTGG + Intronic
1190305547 X:49079726-49079748 TGGTTGGGTCTGGGGGAGGCTGG - Intronic
1190327216 X:49213970-49213992 TAGTAGGGGGCGCCGGAGGGGGG + Intronic
1190392123 X:49942548-49942570 TCGTGGGGTAGGGGGGAGGGGGG - Intronic
1190544584 X:51512461-51512483 TTGTGGGGTGGGGGGAAGGGGGG - Intergenic
1190630902 X:52384850-52384872 TTGTTGGGTGGGGAGGAGGGGGG + Intergenic
1191011615 X:55765563-55765585 TTGTGGGGTCGGGGGGAGGGGGG - Intergenic
1191067920 X:56369961-56369983 TTGTGGGGTGCGGGGGAGGGGGG - Intergenic
1191269986 X:58453441-58453463 TTGTCGGATGGGGGGGAGGGGGG - Intergenic
1191646384 X:63486092-63486114 TACTAGGGTGTGAGAGAAGGGGG + Intergenic
1191813069 X:65210916-65210938 TGGTGGGGTCGGGGGGAGGGGGG + Intergenic
1191844721 X:65538394-65538416 GAAGAGGGGGTGGGGGAGGGAGG + Intergenic
1191985033 X:66970485-66970507 TTGTGGGGTGGGGAGGAGGGGGG - Intergenic
1192002531 X:67169713-67169735 TGGTGGGGTCGGGGGGAGGGGGG + Intergenic
1192167099 X:68833067-68833089 TACAAGGGGGTGGGGGTGGGGGG + Intronic
1192305592 X:69956488-69956510 TAGCCGGGTGTGGTGGTGGGGGG - Intronic
1192317927 X:70066626-70066648 CAGATGGGTGTGGGGTAGGGAGG + Intergenic
1192817259 X:74607184-74607206 AAGTGGGGTGGGTGGGAGGGAGG + Intronic
1193445906 X:81602037-81602059 GGGTGGGGTGTGTGGGAGGGAGG + Intergenic
1193609792 X:83616800-83616822 TAGTAGGGTGTGAGGAAGTGGGG - Intergenic
1193846888 X:86482987-86483009 TTGTGGGGTGGGGGGGAGGGAGG + Intronic
1194225120 X:91246833-91246855 TAGTGGGGTGGGGGTGGGGGTGG - Intergenic
1194280978 X:91954106-91954128 TGGTAGGGGGAAGGGGAGGGAGG - Intronic
1194512506 X:94813348-94813370 TTGTGGGGTGGGGGGAAGGGGGG + Intergenic
1195006478 X:100690455-100690477 GAGAAGAGTGAGGGGGAGGGAGG + Intronic
1195271774 X:103238505-103238527 TTGTGGGGTGGGGGGGGGGGAGG + Intergenic
1195384650 X:104302734-104302756 TAGAAGGGTGTGGTTGAGAGGGG + Intergenic
1195409204 X:104550617-104550639 TTGTGGGGTGGGGGGGAGGGGGG + Intergenic
1195582183 X:106517706-106517728 TTGTAGGGTGTAGGGGGTGGAGG - Intergenic
1195730967 X:107966948-107966970 TTGTGGGGTGGGGGGGAGGGGGG - Intergenic
1195887143 X:109650524-109650546 TTGTGGGGTGGGGGGAAGGGGGG + Intronic
1196264179 X:113622236-113622258 TAGTAGGGTCAGGGAGGGGGTGG + Intergenic
1196304211 X:114082556-114082578 TATCATGGGGTGGGGGAGGGGGG - Intergenic
1196337835 X:114559281-114559303 TTGTGGGGTGGGGGGGAGGGGGG + Intergenic
1196359000 X:114830841-114830863 TTGTGGGGTGGGGGGGAGGGGGG - Intronic
1196621291 X:117827592-117827614 TTGTGGGGTGGGGGGGAGGGGGG - Intergenic
1196668195 X:118338403-118338425 TCGTGGGGTGAGGGGGAGGGGGG - Intergenic
1196853225 X:119958709-119958731 TAGCTGGGTGTGGTGGGGGGGGG + Intergenic
1196866803 X:120077837-120077859 TAGTAGGGTGTGGGGGAGGGGGG + Intergenic
1196876296 X:120158444-120158466 TAGTAGGGTGTGGGGGAGGGGGG - Intergenic
1197086651 X:122484524-122484546 TGGGAGTGTGTGGGGGAGTGAGG + Intergenic
1197187231 X:123601391-123601413 AAGGAGGGAGTAGGGGAGGGAGG + Intronic
1197392408 X:125883735-125883757 TTCTAGGGTCTGGAGGAGGGTGG - Intergenic
1197414127 X:126153550-126153572 TTGTGGGGTGGGGGGGGGGGAGG - Intergenic
1197518344 X:127465176-127465198 TATGAGGGTTTGGGGGAGGTGGG + Intergenic
1197761436 X:130030951-130030973 AAGCAAGGGGTGGGGGAGGGCGG + Intronic
1197920248 X:131584570-131584592 GGGTGGGGTGGGGGGGAGGGGGG + Intergenic
1198394622 X:136208955-136208977 AAGAAGGGGGTGGGGGAGGGTGG + Intronic
1198652100 X:138874000-138874022 TTGTGGGGTGGGGGGGAGGGGGG + Intronic
1198980083 X:142385736-142385758 TTGTGGGGTGGGGGGGAGGGGGG - Intergenic
1199063922 X:143391354-143391376 GAGGTGGGAGTGGGGGAGGGGGG - Intergenic
1199233684 X:145467681-145467703 TAGCAGGGAGTGGGGGGTGGAGG - Intergenic
1199411444 X:147528550-147528572 GAGAAGGGAGAGGGGGAGGGGGG - Intergenic
1199866466 X:151854186-151854208 TATTTGGGTGTGTAGGAGGGTGG + Intergenic
1199990812 X:152986929-152986951 TGGGAGGGTGTGGGGGAATGAGG - Intergenic
1200033901 X:153316403-153316425 TGGGAGGGTGTGGGGGAATGAGG - Intergenic
1200094602 X:153651356-153651378 TTGGAGGGTTTGGGGGAAGGTGG + Intergenic
1200165022 X:154029907-154029929 TGGTTGGGAGTGGGGGAGGTGGG + Intronic
1200314247 X:155115242-155115264 TACTTGGGTGTGGGGAGGGGAGG + Intronic
1200352424 X:155512312-155512334 TTGTGGGGTGGGGGGAAGGGGGG - Intronic
1200561586 Y:4710140-4710162 TAGTGGGGTGGGGGTGGGGGTGG - Intergenic
1200785568 Y:7257593-7257615 AAGCAGGGAGTGAGGGAGGGAGG - Intergenic
1201153805 Y:11111773-11111795 TAGCTGGGTGTGGTGGTGGGGGG + Intergenic
1201249802 Y:12045357-12045379 TTGTGGGGTGGGGGGGAGGGGGG + Intergenic
1201365525 Y:13202344-13202366 GAGTAGGAAGTGGGGGAGGGGGG + Intergenic
1201387881 Y:13463010-13463032 TTGTGGGGTTGGGGGGAGGGGGG - Intronic
1202082484 Y:21098813-21098835 TTGTGGGGTGTGGGAGAGGGAGG - Intergenic
1202378305 Y:24257240-24257262 GTGTGGAGTGTGGGGGAGGGAGG + Intergenic
1202492477 Y:25412881-25412903 GTGTGGAGTGTGGGGGAGGGAGG - Intergenic