ID: 1196876297

View in Genome Browser
Species Human (GRCh38)
Location X:120158445-120158467
Sequence GTAGTAGGGTGTGGGGGAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2248
Summary {0: 2, 1: 0, 2: 12, 3: 260, 4: 1974}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196876297_1196876320 29 Left 1196876297 X:120158445-120158467 CCCCCTCCCCCACACCCTACTAC 0: 2
1: 0
2: 12
3: 260
4: 1974
Right 1196876320 X:120158497-120158519 AACGCGTGCTCTCCCTCATCCGG 0: 2
1: 0
2: 0
3: 0
4: 47
1196876297_1196876321 30 Left 1196876297 X:120158445-120158467 CCCCCTCCCCCACACCCTACTAC 0: 2
1: 0
2: 12
3: 260
4: 1974
Right 1196876321 X:120158498-120158520 ACGCGTGCTCTCCCTCATCCGGG 0: 2
1: 0
2: 0
3: 4
4: 84

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196876297 Original CRISPR GTAGTAGGGTGTGGGGGAGG GGG (reversed) Intergenic
Too many off-targets to display for this crispr