ID: 1196876298

View in Genome Browser
Species Human (GRCh38)
Location X:120158446-120158468
Sequence TGTAGTAGGGTGTGGGGGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1861
Summary {0: 2, 1: 0, 2: 8, 3: 206, 4: 1645}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196876298_1196876320 28 Left 1196876298 X:120158446-120158468 CCCCTCCCCCACACCCTACTACA 0: 2
1: 0
2: 8
3: 206
4: 1645
Right 1196876320 X:120158497-120158519 AACGCGTGCTCTCCCTCATCCGG 0: 2
1: 0
2: 0
3: 0
4: 47
1196876298_1196876321 29 Left 1196876298 X:120158446-120158468 CCCCTCCCCCACACCCTACTACA 0: 2
1: 0
2: 8
3: 206
4: 1645
Right 1196876321 X:120158498-120158520 ACGCGTGCTCTCCCTCATCCGGG 0: 2
1: 0
2: 0
3: 4
4: 84

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196876298 Original CRISPR TGTAGTAGGGTGTGGGGGAG GGG (reversed) Intergenic
900006966 1:64502-64524 TGTTGTGGGGTGGGGGGAAGGGG + Intergenic
900088200 1:908616-908638 GGGAGGAGGGGGTGGGGGAGAGG + Intergenic
900131723 1:1090065-1090087 TGGAGAAGGGTCTGGGGGAGTGG - Intronic
900142659 1:1145116-1145138 TGTGGTTGGGTGTGGAGGGGAGG - Intergenic
900303318 1:1988846-1988868 TGGAGGTGGGTGTGGGGGGGTGG - Intronic
900690382 1:3977235-3977257 TGTAGAGGGGAGTGGGGGAACGG + Intergenic
900732254 1:4269800-4269822 TGTTGTGGGGTTGGGGGGAGGGG + Intergenic
901285720 1:8077127-8077149 TTTAGCAGGGGTTGGGGGAGGGG + Intergenic
901959752 1:12816260-12816282 TGTGGTGGGGTCGGGGGGAGGGG - Intergenic
902590346 1:17469515-17469537 TGAAGAAGGGGGTGGGGGTGGGG + Intergenic
902838376 1:19060545-19060567 TGGAGTGGGGGGTGGGGGAATGG - Intergenic
903096142 1:20976322-20976344 TGTTGTGGGGTGGGGGGAAGGGG - Intronic
903258865 1:22120519-22120541 TGTGGGAGAGGGTGGGGGAGAGG + Intronic
904535773 1:31198619-31198641 TGAAGTAGGGTGGAGGGCAGGGG - Intronic
904695225 1:32326785-32326807 TGAAGTAGGGTGGGAGGGAGGGG + Intronic
905266709 1:36759304-36759326 TGTTGTGGGGTGGGGGGAAGGGG + Intergenic
905637804 1:39566878-39566900 TGTAGTAGGGAGTTGGCCAGAGG - Intronic
906273746 1:44501035-44501057 TGCAGAAGGCTGTGGGGGTGGGG + Intronic
906392183 1:45427768-45427790 TAGTGTGGGGTGTGGGGGAGTGG + Intronic
906623870 1:47308617-47308639 AGTAGTAGGGGTTGGGTGAGAGG + Intronic
906732459 1:48094723-48094745 TGTTGTGGGGTGGGGGGAAGGGG - Intergenic
906820200 1:48921156-48921178 TGTAATGGGGAGAGGGGGAGGGG + Intronic
906993025 1:50759297-50759319 TGTTGTGGGGTGGGGGGGAGGGG - Intronic
907332141 1:53678316-53678338 TGCAGGAGGGTGAGGGGGGGGGG + Intronic
907370294 1:53997979-53998001 TGTCGTGGGGTGCGGGGCAGGGG + Intergenic
907692509 1:56683603-56683625 TATATTAGTGTGTGGTGGAGGGG + Intronic
907706109 1:56834090-56834112 TGTCGTAGGGTGGGGGGAGGGGG + Intergenic
907837698 1:58126604-58126626 TGTTGTGGGGTGGGGGGTAGGGG - Intronic
907998333 1:59655423-59655445 TGTGGTGGGGTGGGGTGGAGGGG - Intronic
908071680 1:60467194-60467216 TGTTGTGGGGTGGGGGGAAGGGG + Intergenic
908095960 1:60738871-60738893 TGTTGTGGGGTGGGGGGGAGGGG + Intergenic
908096398 1:60743311-60743333 TGTTGTGGGGTGGGGGGGAGGGG + Intergenic
908102250 1:60803664-60803686 TGTCGTGGGGTGGGGGGCAGGGG - Intergenic
908417241 1:63925159-63925181 TGTTGTGGGGTGGGGGGAAGGGG - Intronic
908631918 1:66118561-66118583 TGTTGTGGGGTGGGGGGAAGGGG + Intronic
908638757 1:66198756-66198778 TGTTGTGGGGTGGGGGGAAGGGG - Intronic
908865491 1:68544513-68544535 TGTTGTAGGGTGGGGGAGGGGGG - Intergenic
908895119 1:68889587-68889609 GGTTGTGGGGTTTGGGGGAGAGG + Intergenic
909186449 1:72492395-72492417 TGTCGTGGGGTGTGGGGATGGGG + Intergenic
909310012 1:74133706-74133728 TGTCGTGGGGTGGGGGGAAGGGG + Intronic
909317369 1:74240927-74240949 TGTTGTGGGGTGTGGGGAGGGGG - Intronic
909585066 1:77280937-77280959 TGTAGGAGGGTGTGTGAGAGAGG - Intergenic
909747831 1:79121210-79121232 TGTTGTGGGGTGGGGGGGCGGGG - Intergenic
909868323 1:80703724-80703746 TGTTGTGGGGTGGGGGGGAGGGG + Intergenic
910337225 1:86148495-86148517 TGTTGTGGGGTGGGGGGAAGGGG - Intronic
910346520 1:86245127-86245149 TGTTGTAGGGTGGGGGAGGGGGG + Intergenic
910439981 1:87242007-87242029 TGGAGTAGGGTGGGGGTCAGTGG + Intergenic
910600647 1:89028665-89028687 TGTCGTGGGGTGGGGGGCAGGGG - Intergenic
910811519 1:91242261-91242283 TGTGGTGGGGTGGGGGGAAGGGG + Intergenic
910817122 1:91302777-91302799 TGTTGTGGGGTGGGGGGGAGGGG + Intronic
911019104 1:93368656-93368678 TGTAGTAGGGTGTAGTAGTGTGG + Exonic
911261700 1:95693996-95694018 TGTGGCGGGGTGAGGGGGAGGGG + Intergenic
911308525 1:96262246-96262268 TGTTGTGGGGTGAGGGGAAGGGG + Intergenic
911361638 1:96884255-96884277 TGTTGTGGGGTGGGGGGAAGGGG - Intergenic
911574957 1:99564283-99564305 TGTTGTGGGGTGTGGGGAGGGGG + Intergenic
911791346 1:102019259-102019281 TGTTGTAGTGTGTGGGGAGGGGG + Intergenic
911809291 1:102253461-102253483 AATAGTAGGCTGTCGGGGAGAGG - Intergenic
912470710 1:109904942-109904964 TGTGGTGGGGGGTGGGGGACGGG - Intergenic
912478634 1:109960430-109960452 TGTAGTCGGGAGGGGTGGAGGGG + Intergenic
912640544 1:111341202-111341224 TGTTGTGGGGTGGGGGGAAGGGG + Intergenic
912889587 1:113514620-113514642 TGTTGTGGGGTGTGGGGGAGGGG + Intronic
913035356 1:114959722-114959744 GGTAGTAGGGAGGAGGGGAGGGG - Intronic
913154145 1:116077823-116077845 AGTAGGAGGGATTGGGGGAGGGG + Intergenic
913164279 1:116170439-116170461 AGTACTGTGGTGTGGGGGAGGGG + Intergenic
913197760 1:116472122-116472144 GGAAGTAGGGTGTGGTAGAGGGG - Intergenic
913243480 1:116851216-116851238 TGTAGTGGGGTGGGGGGAGGGGG - Intergenic
913434957 1:118837416-118837438 TGTTGTGGGGTGTGGGGAGGGGG + Intergenic
913641892 1:120820291-120820313 TGTTGTAGGGTGGGGGGAGGGGG + Intronic
914044816 1:144082364-144082386 TGTTGTGGGGTGTGGGGAGGGGG + Intergenic
914133294 1:144878322-144878344 TGTTGTGGGGTGTGGGGAGGGGG - Intergenic
914337778 1:146731383-146731405 TGTTGTGGGGTCGGGGGGAGGGG - Intergenic
914376504 1:147077863-147077885 GGTATTACGGGGTGGGGGAGGGG - Intergenic
914401184 1:147321942-147321964 TGTTGTGGGGTGGGGGGGAGGGG - Intergenic
914797029 1:150928740-150928762 TGTCGTGGGGTGGGGGGAAGGGG - Intronic
914815775 1:151060957-151060979 TGTAGGAGGGAGTTTGGGAGGGG + Intronic
914830790 1:151169564-151169586 TTTGGTAGGAGGTGGGGGAGGGG - Exonic
914992962 1:152514561-152514583 CCTAGCAGGGTCTGGGGGAGAGG + Intronic
915644593 1:157259899-157259921 TGTTGTGGGGTGTGGGGAGGAGG + Intergenic
915760789 1:158309826-158309848 TGTTGTGGGGTGGGGGGAAGGGG + Intergenic
915767904 1:158385515-158385537 TGTTGTGGGGTGGGGGGCAGGGG - Intergenic
915861079 1:159445019-159445041 TGTTGTAGGGTGGGGGGAGGGGG + Intergenic
915867885 1:159525192-159525214 TGTTGTGGGGTGGGGGGGGGGGG - Intergenic
915920444 1:159972220-159972242 GGCTGTAGGGTGTGGGTGAGGGG - Intergenic
916615324 1:166433579-166433601 TGTTGTGGGGTGTGGGGAGGGGG - Intergenic
916616079 1:166441795-166441817 TGTTGTGGGGTGGGGGGAAGGGG - Intergenic
916815548 1:168349009-168349031 TGTTGTGGGGTGGGGGGGGGGGG - Intergenic
916945498 1:169722160-169722182 TGTGTTGGGGTGTGGGGGTGTGG + Intronic
917358594 1:174152606-174152628 AGGGGTAGGGTGTGGTGGAGAGG + Intergenic
917413110 1:174780716-174780738 TGTTGTGGGGTGGGGGGGTGGGG - Intronic
917548806 1:176002502-176002524 TGTTGTGGGGTGGGGGGGAAGGG - Intronic
918429935 1:184449195-184449217 TGTTGTAGGGTGGGGGGAAGGGG - Intronic
918467318 1:184834004-184834026 TGTTGTGGGGTGGGGGGCAGGGG - Intronic
918616043 1:186545443-186545465 TGTCGTGGGGTGTGGGGCTGGGG - Intergenic
918651256 1:186966185-186966207 TGTAAGAGGATGTGGGGAAGAGG + Intronic
918946470 1:191072087-191072109 TGTTGTGGGGTGGGGGGAAGGGG + Intergenic
919019954 1:192092710-192092732 TGTTGTGGGGTGGGGGGGAGGGG - Intergenic
919020446 1:192098458-192098480 TGTTGTGGGGTGGGGGGGAGGGG - Intergenic
919136020 1:193508879-193508901 TGTCGTGGGGTGTGGGGCAAAGG - Intergenic
919148956 1:193670669-193670691 TGTCGTAGGGTGAGGGGCTGGGG - Intergenic
919161578 1:193837164-193837186 TGTCGTGGGGTGGCGGGGAGTGG + Intergenic
919171478 1:193959575-193959597 TGTTGTAGGGTGAGGGGGCGGGG + Intergenic
919228394 1:194739112-194739134 TGTCGTGGGGTGGTGGGGAGTGG - Intergenic
919255197 1:195111641-195111663 TGTTGTGGGGTGTGGGAGGGGGG + Intergenic
919391054 1:196986514-196986536 TGTTGTAGGGTGGGAGGTAGGGG - Intronic
919435245 1:197550657-197550679 TGTTGTGGGGTGAGGGGGGGGGG + Intronic
919520061 1:198577269-198577291 TGTTGTGGGGTGGGGGGAAGGGG - Intergenic
919682648 1:200451763-200451785 TGTCGTGGGGTGGGGGGCAGGGG - Intergenic
919717077 1:200790022-200790044 GGTGGTAAGGTGTGGGGGAGAGG + Intronic
919754157 1:201056344-201056366 TGAGGTGGGGTGTGGGTGAGAGG - Intronic
919977699 1:202623449-202623471 TGTTGTGGGGTGCTGGGGAGTGG - Intronic
920053629 1:203177864-203177886 TGGAGTGGGGTGTGGGGAGGGGG - Intergenic
920257042 1:204662543-204662565 TGTAGCAGGCTGAGAGGGAGAGG - Intronic
920639327 1:207736327-207736349 TGTGGTGGGGTGGGGGGAAGGGG + Intronic
920897217 1:210065872-210065894 TGTTGTGGGGTGGGGGGAAGGGG - Intronic
920903891 1:210140673-210140695 TTTAATACGGTGTGAGGGAGAGG + Intronic
921306313 1:213800151-213800173 TTTAGCAGGGTGGGGGTGAGGGG + Intergenic
921337232 1:214100438-214100460 TGTAGTAGGGTTTTGAGCAGAGG + Intergenic
921364074 1:214357303-214357325 TGGGGTGGGGCGTGGGGGAGAGG + Exonic
921673903 1:217955953-217955975 GGTGGTAAGGTGTGGGGGAAGGG - Intergenic
921705664 1:218320206-218320228 TGTTGTGGGGTGGGGGGAAGGGG - Intronic
921845038 1:219869425-219869447 TGTTGTGGGGTGTGGGGAGGGGG + Intronic
921872251 1:220153747-220153769 TGTCGTGGGGTGGGGGGAAGGGG - Intronic
922129460 1:222762568-222762590 TGTTGTGGGGTGGGGGGGAGGGG + Intergenic
922373821 1:224940667-224940689 TGTTGTGGGGTGGGGGGAAGGGG - Intronic
922843319 1:228662676-228662698 TGTTGTAGGGTGGGGGGCTGGGG + Intergenic
922848724 1:228712655-228712677 TGTTGTAGGGTGGGGGGAGGGGG + Intergenic
923448218 1:234092394-234092416 TGTAGGAGGGGGTGGGAGAGGGG - Intronic
923622067 1:235587561-235587583 TGTGGGAGGGTGTGGGGTGGCGG + Intronic
924098265 1:240576603-240576625 TGTAGTGGGAAGTGGGGGAGGGG + Intronic
924359038 1:243216350-243216372 TGTTGTGGGGTCGGGGGGAGGGG - Intronic
924733298 1:246731859-246731881 TGTCGTGGGGTGGGGGGCAGGGG - Intronic
924853474 1:247854078-247854100 TTCAGTAGGGTGTGACGGAGTGG - Intergenic
924902382 1:248414921-248414943 TGTTGTGGGGTCGGGGGGAGAGG + Intergenic
924943305 1:248827215-248827237 TGTACTCGGGGGTGGGGGTGGGG - Intergenic
1062919221 10:1266499-1266521 TGTGGTGGGGGGTGGGGGGGGGG + Intronic
1062957087 10:1547523-1547545 TGTACTGTGTTGTGGGGGAGTGG + Intronic
1063278550 10:4598609-4598631 TGTTGTGGGGTGGGGGGGAGGGG + Intergenic
1063660913 10:8034726-8034748 GGCGGGAGGGTGTGGGGGAGGGG - Intergenic
1063730395 10:8690102-8690124 TGTTGTGGGGTGTGGGGAGGAGG - Intergenic
1063813999 10:9750172-9750194 TGTGGCGGGGGGTGGGGGAGTGG + Intergenic
1063929124 10:11011402-11011424 TGGAGGTGGGTGAGGGGGAGAGG + Intronic
1064068897 10:12208260-12208282 TGTAGTTGTGTGTTGAGGAGGGG + Intronic
1064260917 10:13785767-13785789 TGTCGTGGGGTGGGGGGTAGGGG - Intronic
1064508788 10:16066126-16066148 TGTATTATGGTGTGAGGCAGAGG + Intergenic
1064925436 10:20564092-20564114 TTGAGTAGGGTGTGGGTGAAGGG - Intergenic
1064936029 10:20679943-20679965 TGTCGTGGGGTGGGGGGAAGGGG + Intergenic
1064939641 10:20719651-20719673 TGTCGTGGGGTGGGGGGGGGGGG - Intergenic
1065074823 10:22066697-22066719 TGTAGTGGGGTGGGGGGAGGGGG + Intergenic
1065237311 10:23666563-23666585 TGTTGTAGGGTGGGGGGAGGGGG - Intergenic
1065676188 10:28176872-28176894 TGTCGTGGGGTGGGGGGGTGGGG + Intronic
1066021585 10:31309217-31309239 TGTTGTGTGGGGTGGGGGAGGGG - Intergenic
1066066411 10:31764449-31764471 TGTTGTAGGGTGGGGGGCAAGGG + Intergenic
1066753541 10:38685875-38685897 TGTGGTGGGGTGTGGGGAGGGGG - Intergenic
1067744016 10:48920361-48920383 TGTTGTGGGGTGGGGGGAAGGGG + Intronic
1067974279 10:51006711-51006733 TGTAATGGGGTGGTGGGGAGGGG - Intronic
1068102698 10:52575770-52575792 TGTTGTAGGGAGTGGGGCACAGG - Intergenic
1068268991 10:54695059-54695081 TGGGGTAGGGGGAGGGGGAGGGG + Intronic
1068285961 10:54935075-54935097 TGTTGTGGGGTGTGGGGAGGGGG + Intronic
1068433368 10:56961046-56961068 TGTTGTAGGGTGGGGGGAGGGGG + Intergenic
1068451531 10:57196126-57196148 TGTTGTGGGGTTGGGGGGAGCGG - Intergenic
1068677705 10:59784761-59784783 TGTAGTGGGGTGGGGGGAGGGGG + Intergenic
1068677768 10:59785463-59785485 TGTTGTGGGGTGGGGGGAAGGGG - Intergenic
1068754994 10:60642627-60642649 TGTTGTGGGGTGGGGGGGCGAGG + Intronic
1068813021 10:61277732-61277754 TGTTGTAGGGTGGGGGGTGGGGG + Intergenic
1068928469 10:62564506-62564528 TGGGGTAGGGAGAGGGGGAGGGG - Intronic
1069127907 10:64660492-64660514 TGTGGTGGGGTGGGGGGAAGGGG + Intergenic
1069278241 10:66619557-66619579 TGTTGTAGGGTGGGGGGAGGGGG + Intronic
1069370767 10:67745504-67745526 TGTTGTGGGGTGGGGGGGAGGGG + Intergenic
1069647254 10:70009681-70009703 GGTGGTAAGGTGTTGGGGAGGGG - Intergenic
1070331298 10:75419225-75419247 TGTGGCAGGGTGGGGAGGAGAGG - Intergenic
1070444187 10:76478892-76478914 TGTTGTGGGGTGTGGGGGAGGGG + Intronic
1070531427 10:77340706-77340728 TGTCGTGGGGTCGGGGGGAGGGG + Intronic
1070734507 10:78854219-78854241 TGTTGTGGGGTGTGGGGAGGGGG + Intergenic
1070736714 10:78868050-78868072 GGTAGTAGGGGGTGGGGGGCGGG - Intergenic
1071080789 10:81807446-81807468 GGTGGTAGGGTGTGGGGGGAAGG - Intergenic
1071199878 10:83209414-83209436 TGGAGGAGGGGGTGGGGGTGAGG - Intergenic
1071291969 10:84194976-84194998 GGTAGTGGGGAGTGGGGTAGCGG + Intronic
1071350295 10:84733738-84733760 TGTCGTGGGGTGGGGGGCAGGGG + Intergenic
1071413290 10:85417838-85417860 TGTTGTAGGGTGGGGGGAGGGGG + Intergenic
1071911258 10:90236650-90236672 GGTAGTAGGGAGTGGGAGTGGGG + Intergenic
1072120049 10:92398158-92398180 GGTGGTGAGGTGTGGGGGAGGGG - Intergenic
1072838176 10:98739317-98739339 TGTCGTGGGGAGTGGGGTAGGGG + Intronic
1072844627 10:98816022-98816044 TGTTGTGGGGTGGGGGGGAGGGG + Intronic
1073240049 10:102051323-102051345 AGTAGCTGGGTGTGGTGGAGGGG + Intronic
1073838153 10:107467854-107467876 TGTGGTGGGGTGGGGGGAAGGGG + Intergenic
1074043183 10:109812572-109812594 TGTGGTGGGGTCGGGGGGAGGGG - Intergenic
1074621697 10:115132076-115132098 TGTTGTGGGGTGTGGGGAGGGGG - Intronic
1074636808 10:115327930-115327952 TGTTGTGGGGTGGGGGGAAGTGG + Intronic
1074750251 10:116578951-116578973 TGTTGTGGGGTGAGGGGAAGGGG + Intergenic
1074771801 10:116739813-116739835 GGTAGTTGGGTGATGGGGAGCGG - Intronic
1074848264 10:117418055-117418077 TGGAGTAGGGGGTCAGGGAGGGG + Intergenic
1074984603 10:118646474-118646496 TGTTGTAGGGTGGGGGGATGGGG - Intergenic
1075174332 10:120145157-120145179 GGTGGGAGTGTGTGGGGGAGGGG + Intergenic
1076346202 10:129780386-129780408 TGCAGTGGGGAGTGGGGGATGGG + Intergenic
1076488569 10:130840438-130840460 GATGGTAGGGTGGGGGGGAGGGG - Intergenic
1076880792 10:133238192-133238214 TGGAGATGGGAGTGGGGGAGAGG + Intronic
1077231969 11:1461762-1461784 TGGAAAAGGGTGTGGGGGTGGGG + Intronic
1077348698 11:2078663-2078685 TGTTGTGGGGTGGGGGGGAGGGG - Intergenic
1077373907 11:2196182-2196204 TGTAGCAGGGAGAGGGGTAGAGG + Intergenic
1077428772 11:2503534-2503556 TGTTGTGGGGTTGGGGGGAGGGG + Intronic
1077534113 11:3111146-3111168 TGTGGCAGGGGGTGGGGGTGGGG - Intronic
1077659364 11:4053576-4053598 TGTTGTGGGGTGGGGGGAAGGGG + Intronic
1077696815 11:4400966-4400988 TGTTGTGGGGTGGGGGGGAGGGG - Intergenic
1077717494 11:4596258-4596280 TGTTGTGGGGTGGGGGGAAGGGG + Intergenic
1077791535 11:5446100-5446122 TGTTGTGGGGTGGGGGAGAGTGG + Intronic
1077819423 11:5721946-5721968 TGTTGTGGGGTGGGGGGAAGGGG - Intronic
1077820100 11:5729034-5729056 TGTTGTGGGGTGGGGGTGAGGGG - Intronic
1077829299 11:5847400-5847422 TGTTGTGGGGTGGGGGGAAGGGG - Intronic
1077899667 11:6478537-6478559 AGTTGGAGGGGGTGGGGGAGGGG - Intronic
1078052067 11:7974374-7974396 TGTTGTGGGGTGGGGGGAAGGGG + Intronic
1078128408 11:8591830-8591852 TGTTGTGGGGTGGGGGGGAGTGG + Intronic
1078231357 11:9445869-9445891 TGTAATGGGGTGGGGGGCAGGGG + Exonic
1078419600 11:11198949-11198971 TGTTGTGGGGTGGGGGGAAGGGG - Intergenic
1078646854 11:13148581-13148603 TGTAGAAGGGCGTGGAGGTGAGG - Intergenic
1078812633 11:14783604-14783626 TGTAGTGGGGTGGGGGAGTGGGG + Intronic
1079007133 11:16799948-16799970 TGGAGTAGGGTGTAGGTGTGTGG - Intronic
1079167534 11:18059586-18059608 TGTTGTGGGGTGGGGGAGAGGGG + Intergenic
1079292917 11:19204552-19204574 TGTTGTGGGGTGGGGGGGGGGGG + Intronic
1079337296 11:19581512-19581534 TGTTGTGGGGTGGGGGAGAGGGG - Intronic
1079632227 11:22692151-22692173 TGCAGATGGGGGTGGGGGAGCGG + Intronic
1079841069 11:25399770-25399792 TGTTGTAGGGTGGGGGGAGGGGG + Intergenic
1079864537 11:25718734-25718756 TGTTGTGGGGTGAGGGGAAGGGG - Intergenic
1079965219 11:26971399-26971421 TGTTGTGGGGTGGGGGGAAGGGG + Intergenic
1079983390 11:27175534-27175556 TGTTGTGGGGTGGGGGGAAGGGG - Intergenic
1080220670 11:29899429-29899451 TGTTGTAGGGTGGGGGGAGGCGG + Intergenic
1080645630 11:34185675-34185697 TGGAGTGGGGTTGGGGGGAGAGG + Intronic
1080730756 11:34950521-34950543 TGTTGTGGGGTGGGGGGAAGGGG - Intronic
1080811488 11:35708756-35708778 TGTTGTGGGGTGTGGGGAGGAGG + Intronic
1080918726 11:36687487-36687509 TGTTGTAGGGTGGGGGGAGGGGG - Intergenic
1081211586 11:40341532-40341554 TGTTGTGGGGTGGGAGGGAGGGG + Intronic
1081423142 11:42896352-42896374 TGTTGTGGGGTGGGGGGAAGGGG - Intergenic
1081432885 11:42995869-42995891 TGTTGTGGGGTGGGGGGAAGGGG + Intergenic
1081433242 11:42999506-42999528 TGTTGTGGGGTGGGGGGAAGGGG - Intergenic
1081505588 11:43713274-43713296 TGTTGTAGGGTGGGGGGAGGGGG - Intronic
1081708085 11:45197866-45197888 TGTCGTGGGGTGCGGGGAAGGGG + Intronic
1082090372 11:48084329-48084351 ATTAGTAGGGTGTGTGGGCGTGG - Intronic
1082135266 11:48542132-48542154 TGTTGTGGGGTGGGGGTGAGGGG - Intergenic
1082152689 11:48762116-48762138 TGTTGTGGGGTGGGGGGAAGGGG - Intergenic
1082220125 11:49625014-49625036 TGTTGTGGGGTGGGGGGAAGGGG - Intergenic
1082248169 11:49949073-49949095 TGTTGTAGGGTGGGGGGAGGGGG + Intergenic
1082268536 11:50144825-50144847 TGTTGTGGGGTGGGGGGGGGAGG - Intergenic
1082584141 11:54913299-54913321 TGTTGTGGGGTGGGGGGAAGGGG + Intergenic
1082633417 11:55567392-55567414 TGTTGTGGGGTGGGGGGAAGGGG - Intergenic
1082905510 11:58304286-58304308 TGTTGTGGGGTGGGGGGAAGGGG - Intergenic
1083174500 11:60941096-60941118 TGCAGAGGGGTGTGGGGCAGGGG - Intronic
1083242040 11:61395896-61395918 AGTATTAGGGTGTGGGGAACAGG + Intronic
1083517223 11:63271468-63271490 TGTTGTGGGGTGTGGGGAGGGGG - Intronic
1083522491 11:63328237-63328259 TGTTGTGGGGTGTGGGGAAGGGG - Intronic
1083523998 11:63344567-63344589 TGTTGTGGGGTGGGGGGAAGGGG - Intronic
1083722833 11:64611887-64611909 TGTGGGGGGGTGTGGGTGAGGGG - Intronic
1083955187 11:65978934-65978956 TGGGGTAGGGTGTGGTGGGGAGG + Intronic
1084219998 11:67671982-67672004 TGAAGCAGGGGGTGGGGGTGAGG - Intronic
1084336430 11:68460620-68460642 GGTAGTAGGGGGCGGGAGAGAGG + Intergenic
1084496183 11:69504993-69505015 TGAAGTGGGGAGTGGGGGTGGGG + Intergenic
1085048056 11:73364600-73364622 GGTAGCAGGGGGTGGGGGAATGG + Exonic
1086035738 11:82412137-82412159 TGTTGTGGGGTGTGGGGATGGGG - Intergenic
1086036808 11:82425590-82425612 TGTGGTAAGGTGTGGGGCAAAGG - Intergenic
1086082944 11:82924080-82924102 GGTAGTTGGGAATGGGGGAGAGG - Intronic
1086129031 11:83382119-83382141 TGAAGTGGGGTTTGGGGGAAGGG - Intergenic
1086142291 11:83512678-83512700 TGTTGTGGGGTGGGGGGAAGGGG - Intronic
1086183551 11:83986205-83986227 TGTTGTGGGGTGTGGGGAGGGGG - Intronic
1086245906 11:84752714-84752736 TGTAGTGGGGTGGGGGGAGGGGG - Intronic
1086394153 11:86397030-86397052 TGGAGTAGGGAGTGGGGGTGGGG - Intronic
1086583388 11:88424638-88424660 TGTAGTGGGGTGACGGGGAGAGG + Intergenic
1086586420 11:88457996-88458018 TGTTGTGGGGTGGGGGGAAGGGG - Intergenic
1086629532 11:89000083-89000105 TGTTGTGGGGTGAGGGGAAGGGG + Intronic
1086641410 11:89161653-89161675 TGTTATGGGGTGTGGGAGAGCGG - Intergenic
1086811517 11:91316445-91316467 TGTCGTGGGGTGGGGGGCAGGGG - Intergenic
1086964259 11:93011378-93011400 TGTTGTGGGGTGGGGGGCAGGGG - Intergenic
1087054806 11:93923135-93923157 GGTAGTATCGTGTGGGGGAAAGG - Intergenic
1087372628 11:97303951-97303973 TGTCGTAGGGTGGGGGGAAGGGG + Intergenic
1087447516 11:98274068-98274090 TGTGGTGGGGTGGGGGGGCGAGG - Intergenic
1087794884 11:102445014-102445036 TGTCGTGGGGTGGGGGGAAGGGG + Intronic
1087888683 11:103511449-103511471 TGTTGTGGGGTTGGGGGGAGGGG - Intergenic
1088070557 11:105778931-105778953 TGTTGTAGGGTGGGGGGAGGGGG - Intronic
1088382405 11:109208869-109208891 AGTAACAGGGTGTGGGGTAGGGG - Intergenic
1088920581 11:114257633-114257655 TGGAGTAGAGTGTGGGGGTGAGG - Intergenic
1089044897 11:115491941-115491963 TGTAATGGGGTGAGGGGCAGGGG + Intronic
1089089381 11:115856787-115856809 TGTTGTAGGGTGGGGGGAAGGGG - Intergenic
1089215479 11:116832166-116832188 TGGAGAAGGGAGTAGGGGAGAGG - Intronic
1089458415 11:118639032-118639054 TGGAGTAGGGTAAGTGGGAGGGG + Intronic
1089946380 11:122478384-122478406 TGTGGTGGGGTCGGGGGGAGGGG + Intergenic
1090139292 11:124237535-124237557 TGTAGTGGGGTGGGGGGAGGGGG + Intergenic
1090139868 11:124245160-124245182 TGTAGTGGGGTGGGGGGAGGGGG - Intergenic
1090429361 11:126633221-126633243 TGTTGTGGGGTGGGGGTGAGGGG + Intronic
1090527900 11:127557059-127557081 TGTAGCAGGGTGGGGGGAAAGGG + Intergenic
1090606826 11:128430533-128430555 TGTCGTGGGGTGTGGGGCGGGGG - Intergenic
1090622253 11:128570887-128570909 TGTAGTGGAGTGTTGGGGAGTGG + Intronic
1090674976 11:128983489-128983511 TGTTGTGGGGTGGGGGGAAGGGG + Intronic
1090929280 11:131280704-131280726 TGTAGTATTTTGTTGGGGAGAGG + Intergenic
1091150819 11:133326705-133326727 TGTAGTGGGGTGTGGGTGTAGGG + Intronic
1091160254 11:133413323-133413345 TGTTGTGGGGTAGGGGGGAGGGG + Intronic
1091170093 11:133512385-133512407 TGGAGTAAGGTATGGGGAAGAGG + Intronic
1091658576 12:2363780-2363802 TGTATTAAGGTTTGGGGTAGGGG + Intronic
1091824322 12:3499343-3499365 TGTGGTGGGGTCGGGGGGAGGGG - Intronic
1091915772 12:4271195-4271217 CGGAGTAGGGGGAGGGGGAGAGG + Intergenic
1091916641 12:4274985-4275007 TGAGGTGGGGGGTGGGGGAGAGG - Intronic
1092024031 12:5225854-5225876 TGTAGAAGGGTGATGGGAAGAGG - Intergenic
1092365292 12:7872413-7872435 TGAAGTTGGGAGTGGGGAAGGGG - Intronic
1092518523 12:9241380-9241402 TGTGGTTGGGTGTGGGGGACAGG - Intergenic
1092903020 12:13077417-13077439 TGTTGTGGGGTGGGGGGGAGGGG - Intronic
1092972641 12:13712224-13712246 TGTTGTAGGGTGGGGGGAAGGGG + Intronic
1093160596 12:15741859-15741881 TGTCGTAGGGTTGGGGGAAGGGG - Intronic
1093245778 12:16734395-16734417 TGTCGTGGGGTGGGGGGAAGGGG + Intergenic
1093313676 12:17622708-17622730 TGTTGTGGGGTGGGGGGAAGGGG - Intergenic
1093609037 12:21131982-21132004 TGTTGTGGGGTGGGGGAGAGGGG - Intronic
1093757706 12:22870894-22870916 TGGAGTGGGGAGAGGGGGAGGGG + Intergenic
1093896654 12:24582315-24582337 TGTTGTGGGGTGGGGGGAAGGGG + Intergenic
1094078827 12:26510001-26510023 TGTGGTGGGGGGTGGGGGTGGGG + Intronic
1094234818 12:28151693-28151715 TGTCGTGGGGTGGGGGGCAGGGG - Intronic
1094500256 12:31015330-31015352 TGGAGCGGGGTGTGGGAGAGCGG - Intergenic
1094663635 12:32496431-32496453 TGTTGTAGGGGGTTGGGGAGAGG - Intronic
1094785084 12:33838819-33838841 TGTTGTGGGGTTGGGGGGAGCGG + Intergenic
1094860799 12:34464193-34464215 TGTTGTAGGGTGGGGGGAGGGGG - Intergenic
1094874924 12:34629674-34629696 TGTTGTGGGGTGTGGGGAGGGGG - Intergenic
1095101239 12:38186155-38186177 TGTTGTGGGCTGGGGGGGAGGGG + Intergenic
1095137887 12:38628048-38628070 TGTTGTGGGGTGGGGGGAAGGGG + Intergenic
1095194551 12:39297582-39297604 TGTTGTGGGGTGGGGGGGTGGGG + Intronic
1095276571 12:40291274-40291296 TGTTGTGGGGTGGGGGGAAGGGG + Intronic
1095289350 12:40459521-40459543 TGTAGTGAGGGGTGAGGGAGAGG - Intronic
1095600958 12:44012942-44012964 AGTGGTAGGGTGTGGGGGGAGGG + Intronic
1095803133 12:46289487-46289509 TGTAGTAGGGTGGGGGACTGGGG + Intergenic
1095804068 12:46298968-46298990 TGAAGTAAGGTGTGTGAGAGTGG + Intergenic
1095869555 12:47011147-47011169 TGTCGTGGGGTGGGGGGAAGGGG + Intergenic
1096235146 12:49921323-49921345 TGTAGTTGTGGGTGGGGGGGCGG + Intergenic
1096437820 12:51609810-51609832 TGTTGTGGGGTGTGGGGAGGGGG + Intronic
1096485958 12:51981475-51981497 TGGAGGTGGGTTTGGGGGAGTGG - Intronic
1096838873 12:54369311-54369333 CGGAGTCGGGGGTGGGGGAGAGG + Exonic
1096921465 12:55090981-55091003 TGTCGTGGGGTGGGAGGGAGGGG + Intergenic
1096921807 12:55095295-55095317 TGTTGTGGGGTGGGGGGGTGGGG + Intergenic
1096931641 12:55216499-55216521 TGTTGTGGGGTGGGGGGAAGGGG - Intergenic
1097183605 12:57184633-57184655 AGAAGTGGGGAGTGGGGGAGTGG + Intronic
1097214581 12:57400428-57400450 TGTTGTGGGGTGGGGGGAAGGGG + Intronic
1097407005 12:59201212-59201234 TGTCGTGGGGTGGGGGGAAGGGG + Intergenic
1097453655 12:59767938-59767960 TGTCGTGGGGTGGGGGGAAGGGG + Intronic
1097456379 12:59803648-59803670 GGTGGTAAGGTGTGGGGGAGGGG + Intergenic
1097534865 12:60855926-60855948 TGTTGTGGGGTGGGGGGGAGGGG - Intergenic
1097545824 12:61000504-61000526 TGTAGTGGGGTGGGGGGAGGGGG - Intergenic
1097549263 12:61046753-61046775 TGTTGTGGGGTGGGGGGAAGGGG - Intergenic
1097557200 12:61154076-61154098 TGTTGTGGGGTGGGGGGAAGGGG - Intergenic
1097568443 12:61299750-61299772 TGTTGTGGGGTGTGGGGAGGGGG + Intergenic
1097588107 12:61539694-61539716 TGTTGTGGGGTGTGGGGGGAGGG - Intergenic
1097716257 12:62969911-62969933 TGTGGCTGGGTGTGGGGGCGCGG + Intergenic
1097751179 12:63354575-63354597 TGTTGTGGGGTGGGGGGGAGGGG + Intergenic
1097774904 12:63634058-63634080 TATTGTAGGGTGCGGGGAAGGGG + Intronic
1097863920 12:64543491-64543513 GGGGGGAGGGTGTGGGGGAGTGG - Intergenic
1098057870 12:66527519-66527541 TGTTGTGGGGTGTGGGGATGGGG + Intronic
1098087057 12:66857218-66857240 TGTTGTGGGGTGGGGGGAAGGGG + Intergenic
1098167319 12:67711655-67711677 TGTGGGATGGTGTGGGGGAGTGG + Intergenic
1098474072 12:70879097-70879119 TGTTGTGGGGTGTGGGGAGGGGG + Intronic
1098688122 12:73451564-73451586 TGTTGTAGGGTGGGGGGATGGGG - Intergenic
1098738929 12:74146055-74146077 TGTTGGAGGGTGTGGGGCAAGGG - Intergenic
1098798613 12:74924101-74924123 TGTTGTAGGGTGGGGGGAGGGGG + Intergenic
1098815703 12:75159113-75159135 TGTCGGAGGGTGGGGGGGAAAGG + Intronic
1098835005 12:75413190-75413212 TGTTGTGGGGTGGGGGGAAGGGG + Intronic
1099082585 12:78204199-78204221 TGTTGTGGGGTGGGGCGGAGGGG + Intronic
1099216276 12:79857427-79857449 TGTTGTGGGGTGGGGGGAAGGGG + Intronic
1099309611 12:81002369-81002391 TGTTGTGGGGTGTGGGGAGGGGG - Intronic
1099310409 12:81013740-81013762 TGTAGTAGGGAGAGCAGGAGAGG - Intronic
1099336430 12:81365459-81365481 TTTGGTAGGTGGTGGGGGAGTGG + Intronic
1099436504 12:82652577-82652599 TGCTGTGGGGTGGGGGGGAGGGG - Intergenic
1099551668 12:84053002-84053024 TGTAGTGGGGGTCGGGGGAGAGG - Intergenic
1099592512 12:84612785-84612807 TGTTGTGGGGTGGGGGGAAGGGG - Intergenic
1099712258 12:86242767-86242789 TGTGGTGGGGAGTGGGGGATTGG - Intronic
1099753182 12:86804261-86804283 TGTAGTGGGGTGGGGGGAGGGGG + Intronic
1099912745 12:88852840-88852862 TGTTGTGGGGTGTGGGGAGGGGG + Intergenic
1099938247 12:89153948-89153970 TGTTGTGGGGTGGGGGGAAGGGG - Intergenic
1100520849 12:95374230-95374252 TGTTGTGGGGTGGGGGGAAGGGG + Intergenic
1100575621 12:95889452-95889474 TTGAGTAGGGTGTGGGGGCAGGG - Intronic
1100741915 12:97603361-97603383 TGTTGTAGGGTGGGGGGAGGGGG - Intergenic
1101056599 12:100923282-100923304 TGTCGTAGGGTGGGGGGCTGGGG - Intronic
1101085869 12:101235468-101235490 TGTTGTGGGGTGGGGGGAAGGGG + Intergenic
1101231189 12:102743245-102743267 TGTGGTAGGGTGGGGGGAAGGGG - Intergenic
1101634555 12:106527649-106527671 GGTGGTATGGTGTGGGGGAGGGG - Intronic
1101639028 12:106572275-106572297 TGTTGTAAGGTGTGAGGGAGGGG - Intronic
1101647514 12:106645033-106645055 TGTTCTAGGGGGAGGGGGAGGGG - Intronic
1101672189 12:106885824-106885846 TGGATTTGGGTGGGGGGGAGGGG + Intronic
1101823743 12:108204328-108204350 TGGAGTAGGGTGGGAGAGAGAGG - Intronic
1102203258 12:111072803-111072825 TGAAGTTGGGGTTGGGGGAGGGG - Intronic
1102457859 12:113082079-113082101 TGATGTCGGCTGTGGGGGAGCGG - Intronic
1102667613 12:114588955-114588977 TGTCGTGGGGTGGGGGGAAGGGG + Intergenic
1103180070 12:118903111-118903133 TGTTGTAGGGTGGGGGGCTGGGG - Intergenic
1104519206 12:129457435-129457457 TGTTGTGGGGTAGGGGGGAGGGG + Intronic
1104805773 12:131588317-131588339 TAGAGTAGGGTGGGGTGGAGTGG + Intergenic
1104805873 12:131588688-131588710 TGGGGTAGGGTGGGGTGGAGTGG + Intergenic
1105348371 13:19594557-19594579 TGTTGTAGGGTGGGGGGAGGGGG - Intergenic
1105440388 13:20410378-20410400 TGTAGTGGGGTGGGGGGAGGGGG + Intronic
1105492649 13:20903081-20903103 TGTACTAGGGTAGTGGGGAGAGG - Intergenic
1105565912 13:21547780-21547802 TGTACTTGGGGGTGGGGGTGGGG + Intronic
1105818308 13:24057228-24057250 TGTTGTGGGGTTGGGGGGAGGGG - Intronic
1107224947 13:38038026-38038048 TGTTGTGGGGTGGGGGGCAGGGG - Intergenic
1107686202 13:42901913-42901935 TGTTGTGGGGTGGGGGGAAGGGG - Intronic
1108145651 13:47473636-47473658 TGTTGTGGGGTGGGGGGAAGGGG + Intergenic
1108330801 13:49380485-49380507 GGTATTAGGGCCTGGGGGAGAGG + Intronic
1108760932 13:53563707-53563729 TGTTGTGGGGTGGGGGGAAGGGG - Intergenic
1108811163 13:54224865-54224887 TGTCGTGGGGTGGGGGGAAGGGG + Intergenic
1108839318 13:54593073-54593095 TGGAGTAGGGGGTGGCAGAGAGG - Intergenic
1109210334 13:59527754-59527776 TGTGGTATGGTGGGGTGGAGTGG - Intergenic
1109409736 13:61946233-61946255 TGTAGTGGGGTGTGGGGAAGGGG + Intergenic
1109566214 13:64119634-64119656 TGTTGTGGGGTGGGGGGAAGGGG + Intergenic
1109569947 13:64174756-64174778 TGTTGTGGGGTGAGGGGAAGGGG + Intergenic
1109587278 13:64423042-64423064 TGTTGTGTGGTGGGGGGGAGGGG - Intergenic
1109833615 13:67826369-67826391 TGCCGTGGGGTGGGGGGGAGGGG + Intergenic
1110051795 13:70911117-70911139 TGTTGTGGGGTGGGGGGGAAAGG + Intergenic
1110630586 13:77701913-77701935 TGTAGTGGGGTGGGGGGAGGGGG - Intronic
1110728665 13:78855056-78855078 TGTTGTGGGGTGGGGGAGAGGGG - Intergenic
1110761652 13:79237201-79237223 TGTTGTGGGGTGGGGGAGAGGGG + Intergenic
1110789744 13:79574671-79574693 TGTTGTGGGGTGGGGGGGAGGGG + Intergenic
1111248508 13:85572835-85572857 TGTTGTGGGGTGGGGGGAAGGGG + Intergenic
1111768010 13:92559365-92559387 TGTGTTGGGGTGTGGGGGCGCGG + Intronic
1111812431 13:93107736-93107758 TATTGTGGGGTGGGGGGGAGGGG - Intergenic
1112060479 13:95734966-95734988 TGTTGTGGGGTGGGGGGGAGGGG - Intronic
1112075079 13:95904441-95904463 TGTTGTGGGGTGGGGGGGAGGGG - Intronic
1112188860 13:97155542-97155564 TGTTGTGGGGTGTGGGGAGGGGG - Intergenic
1112249312 13:97764785-97764807 TGTTGTGGGGTGTGGGGAGGGGG - Intergenic
1112484257 13:99805572-99805594 GGAAGGAGGGGGTGGGGGAGGGG + Intronic
1112594217 13:100793078-100793100 TGTTGTGGGGTGGGGGGAAGGGG - Intergenic
1112615238 13:100997626-100997648 AGTAAGAGGGTATGGGGGAGTGG - Intergenic
1112699448 13:101988701-101988723 TGTTGTGGGGTGGGGGGGAGGGG + Intronic
1112817702 13:103292341-103292363 TGTTGCAGGGTGTGGGGGTAGGG - Intergenic
1113072282 13:106433638-106433660 TGTAACCGGGGGTGGGGGAGGGG - Intergenic
1113203475 13:107891707-107891729 TGTGGTGGGGTGGGGGGGAGGGG + Intergenic
1113263554 13:108592443-108592465 GGTATGAGGGTGTGGGGGTGCGG + Intergenic
1113300414 13:109013112-109013134 TGTGGTGGGGTGGGGGGGGGTGG - Intronic
1113413772 13:110112378-110112400 TGTTGTGGGGTGTGGGGATGGGG + Intergenic
1113998194 14:16105259-16105281 TGAAGTAGAGTGTAGTGGAGTGG - Intergenic
1114161576 14:20174222-20174244 TGTTGTGGGGTGGGGGGAAGGGG - Intergenic
1114170441 14:20267344-20267366 TGTTGTGGGGTGTGGGGGGGAGG + Intronic
1114434339 14:22691733-22691755 GGAGGTAGGGAGTGGGGGAGAGG - Intergenic
1114679214 14:24470452-24470474 TGTCGTGGGGTGGGGGGCAGGGG - Intergenic
1114800592 14:25771464-25771486 TGTTGTGGGGTGGGGGGAAGGGG - Intergenic
1114909349 14:27171048-27171070 TGTTGTGGGGTGAGGGGAAGGGG + Intergenic
1114967100 14:27976103-27976125 TGTTGTAGGGTGGGGGGAGGGGG - Intergenic
1115041648 14:28938055-28938077 TGTAGTGGGGTGGGGGGCAGGGG - Intergenic
1115108129 14:29785667-29785689 TGTTGTGGGGTGGGGGGAAGGGG + Intronic
1115221993 14:31067418-31067440 TGTGGTAGGGTGGGGGGAGGGGG - Intronic
1115477689 14:33831759-33831781 TGTTGTGGGGTGGGGGGGAAGGG + Intergenic
1115537459 14:34386477-34386499 TGTTGTAGGGTGGGGGGAGGGGG + Intronic
1115668618 14:35582969-35582991 GGTGGTAAGGTGTGGGGGAAGGG - Intronic
1115669013 14:35587713-35587735 TGTCGTGGGGTGGGGGGAAGGGG + Intronic
1115823811 14:37241561-37241583 TGCGGCAGGGTGTGGGGGTGAGG + Intronic
1115878008 14:37882246-37882268 TGTTGTGGGGTGGGGGGGGGGGG - Intronic
1115953400 14:38748083-38748105 TGTTGTGGGGTAGGGGGGAGCGG - Intergenic
1115955081 14:38768680-38768702 TGTTGTGGGGTTGGGGGGAGGGG + Intergenic
1115971123 14:38945896-38945918 TGTGGTGGGGTGTGGGGAAGAGG - Intergenic
1116022712 14:39481375-39481397 TGTCGTGGGGTGTGGGGAGGGGG - Intergenic
1116150777 14:41139704-41139726 TGTTGTGGGGTGGGGGGAAGGGG - Intergenic
1116168814 14:41371400-41371422 TGTTGTGGGGTGGGGGGAAGGGG - Intergenic
1116281173 14:42910188-42910210 TGGGGTAGGGGGAGGGGGAGGGG - Intergenic
1116358340 14:43960075-43960097 TGTTGTGGGGTGTGGGGAGGGGG + Intergenic
1116609259 14:47045998-47046020 TGTTGTGGGGTGTGGGGAGGGGG + Intronic
1116707007 14:48315327-48315349 TGTAGTGGGGTGGGGGGAGGGGG + Intergenic
1116985375 14:51213768-51213790 TGTTGTAGGGTGGAGGGGAGGGG - Intergenic
1117116195 14:52515564-52515586 TGCAGTAGAGGGTGGGGGAGTGG - Intronic
1117441292 14:55761945-55761967 TGTAATAGGGAGTGAGGGAATGG - Intergenic
1117517400 14:56515394-56515416 TGAAGCAGGGGATGGGGGAGAGG - Intronic
1117653090 14:57926714-57926736 TGAAGTAGGGTTGGGGGGGGGGG + Intronic
1117853028 14:59994856-59994878 TGTTGTGGGGTGGGGGGAAGGGG + Intronic
1118181046 14:63493501-63493523 TGTGGTGGGGGGAGGGGGAGGGG + Intronic
1118182595 14:63508099-63508121 TGTAGAAGTGTGTGTGGGGGTGG - Intronic
1118245720 14:64108478-64108500 TACAGCAGGGTGTGGGGGATGGG + Intronic
1118467226 14:66041934-66041956 TGTCGTGGGGTAGGGGGGAGGGG + Intergenic
1118511466 14:66479445-66479467 TACAGTAGGGTGTGGGGATGGGG - Intergenic
1119096553 14:71838243-71838265 TGTTGTGGGGTGGGGGAGAGGGG - Intergenic
1119097069 14:71843110-71843132 TGTTGTGGGGTGGGGGGCAGGGG - Intergenic
1119154392 14:72395678-72395700 TGTTGTGGGGTGGGGGGAAGGGG - Intronic
1119216584 14:72873918-72873940 TGTTGTGGGGTGGGGGGAAGGGG + Intronic
1119231478 14:72983344-72983366 TGTGGTGGGGTGGGGGGGAGGGG - Intronic
1119329992 14:73786820-73786842 TGAGGTAGGGTGGGGGGAAGGGG - Intronic
1119796077 14:77398646-77398668 TGTAGTAAGGAGTTGAGGAGGGG - Intronic
1120007845 14:79380343-79380365 TGTTGTGGGGTGGGGGGAAGGGG - Intronic
1120054457 14:79906469-79906491 TGTTGTGGGGTGGGGGGAAGGGG + Intergenic
1120057092 14:79936916-79936938 TGTTGTGGGGTGTGGGGAGGGGG + Intergenic
1120116437 14:80623304-80623326 TGTTGTGGGGTGGGGGGAAGGGG + Intronic
1120148980 14:81012086-81012108 TGTTGTGGGGTGGGGGGAAGGGG - Intronic
1120274415 14:82353402-82353424 TGTGGTGGGGTGGGGGGAAGGGG + Intergenic
1120328191 14:83055141-83055163 AGTAGTAGGGGGTGGGGTATGGG - Intergenic
1120426469 14:84353901-84353923 TGGAGAAGGGTGGGAGGGAGAGG + Intergenic
1120542883 14:85772378-85772400 TGTTGTGGGGTGGGGGGGCGGGG - Intergenic
1120564510 14:86038320-86038342 TGTAGTAGGGTATGGGGAACAGG - Intergenic
1120608405 14:86608622-86608644 TGTTGTAGGGTGGGGGGAAGGGG - Intergenic
1120848504 14:89147479-89147501 TGCAGTGGGTTGTGGGGGAATGG + Intronic
1120950708 14:90039405-90039427 TAAAGTAGGGTGTGGGGGCAGGG - Intronic
1121013862 14:90536591-90536613 TGGAGCTGGGTGTGAGGGAGGGG - Exonic
1121237584 14:92403828-92403850 TGTGCCAGGGTGGGGGGGAGGGG - Intronic
1121363724 14:93287320-93287342 TGTAGGACGGGGTGGGGGGGCGG - Intronic
1121413676 14:93764277-93764299 TGAAGGCGGGGGTGGGGGAGGGG - Intronic
1121447440 14:93987942-93987964 GGAAGGAGGGAGTGGGGGAGGGG + Intergenic
1121760063 14:96437063-96437085 GGTAGTAGGGGGTGGGGGGAGGG + Intronic
1122706913 14:103627743-103627765 TGTAGTAGGGCGTAAGGGAGCGG + Intronic
1122782663 14:104150193-104150215 AGGAGGAGGGGGTGGGGGAGGGG - Intronic
1123012392 14:105355784-105355806 TGCAGTAGGGCGTGGGGGCCTGG + Intronic
1123054525 14:105562745-105562767 TGTATGAGGGTGTGGGTGTGAGG + Intergenic
1123175062 14:106409117-106409139 TGTAGTGGGGTTGGGGGAAGGGG + Intergenic
1123207968 14:106731981-106732003 TGTTGTGGGGGTTGGGGGAGGGG - Intergenic
1123397739 15:19954198-19954220 TGTTGTGGGGTGAGGGGGTGTGG + Intergenic
1123676236 15:22712963-22712985 TGTTGTGGGGTGGGGGGGAGGGG - Intergenic
1123961731 15:25409989-25410011 TGTTGTGGGGTGGGGGGAAGGGG + Intronic
1124122299 15:26898357-26898379 TGTTGAAGCGTGTGGGTGAGTGG - Intronic
1124344915 15:28915894-28915916 TGTAGTATGGTGTGGGTGTGTGG - Intronic
1124461899 15:29899786-29899808 TGTGTTAGTGTGTGGGTGAGTGG - Intronic
1124463484 15:29914832-29914854 TGTTGCAGGGTGTGGGAGAGGGG - Intronic
1124493347 15:30171813-30171835 TGTTGTGGGGTGCTGGGGAGTGG - Intergenic
1124493538 15:30172934-30172956 TGTAGTAGGGTGTGTATGTGTGG + Intergenic
1124645498 15:31435162-31435184 TGTTGTAGGCTGTGGGGGCGGGG + Intronic
1124750187 15:32366512-32366534 TGTTGTGGGGTGCTGGGGAGTGG + Intergenic
1124962341 15:34408459-34408481 TGTAGTATGGTGTGGGTGTGTGG - Intronic
1124978965 15:34554681-34554703 TGTAGTATGGTGTGGGTGTGTGG - Intronic
1125224365 15:37378668-37378690 TGTCGTGGGGTGGGGGGAAGGGG - Intergenic
1125432380 15:39608928-39608950 TGTGGCAGGGTTTGGGGGAGTGG - Intronic
1125481982 15:40087475-40087497 TGGGGTAGTGTGTGCGGGAGGGG + Intergenic
1125490097 15:40140826-40140848 TTTTGTCGGGTGGGGGGGAGCGG + Intergenic
1125837922 15:42770097-42770119 TGTCGTGGGGTGGGGGGCAGGGG + Intronic
1125889910 15:43258073-43258095 TGTCGTGGGGTGGGGGGAAGAGG + Intronic
1125980881 15:44000272-44000294 TGTGGTAGGGTGAGGTGCAGTGG - Intronic
1126026688 15:44453571-44453593 TGTCGTGGGGTGGGGGGGATGGG - Intronic
1126070047 15:44858296-44858318 TGTTGTGGGGTTGGGGGGAGGGG + Intergenic
1126086443 15:45014856-45014878 TGTTGTGGGGTGGGGGGCAGGGG - Intergenic
1126123730 15:45276325-45276347 TGTTGTGGGGTGAGGGGAAGGGG + Exonic
1126307531 15:47277758-47277780 TGTTGTGGGGTGTGGGGAGGGGG - Intronic
1126364801 15:47883199-47883221 TATAGTGTGTTGTGGGGGAGGGG + Intergenic
1126812528 15:52422395-52422417 TGTTGTAGGGTGGGGAGTAGGGG - Intronic
1126918623 15:53494946-53494968 TGTGGTAGGGTGGGGGGAGGGGG - Intergenic
1127228051 15:56955397-56955419 TGTCGTAGGGTGGGGGGCTGGGG + Intronic
1127305459 15:57701230-57701252 TGTTGTGGGGTGTCAGGGAGAGG - Intronic
1127385284 15:58461924-58461946 TGGAGTGGGATGTGGGGGCGGGG - Intronic
1127640714 15:60913363-60913385 TGTAGGAGGCTGGGGTGGAGGGG - Intronic
1127859766 15:62983660-62983682 TGTGGTTGGGAGTGGTGGAGAGG - Intergenic
1128144917 15:65327795-65327817 TGTGGGAGGGTGAGGGGGTGTGG - Exonic
1128810904 15:70571977-70571999 TGTAGTAGCGAGTAGGGAAGTGG + Intergenic
1128848576 15:70926664-70926686 TGTTGTGGGGTGGGGGGAAGGGG - Intronic
1128889665 15:71319394-71319416 TGTTGTGGGGTGGGGGGAAGGGG - Intronic
1129096624 15:73216078-73216100 TGTTGTGGGGTGTGGGGAGGGGG - Intronic
1129145886 15:73646812-73646834 TGGAGGAGGGGGAGGGGGAGGGG + Intergenic
1129182307 15:73885132-73885154 AGTAGTGGGGGGTTGGGGAGGGG - Intronic
1129872509 15:78949667-78949689 AGTTGTGGGGGGTGGGGGAGGGG - Intergenic
1130010482 15:80149528-80149550 TGTTGTAGGGTGGGGAGAAGGGG - Intergenic
1130013612 15:80171240-80171262 TGTTGTGGGGTGGGGGGAAGAGG - Intronic
1130205332 15:81870238-81870260 TGTTGTAGGGTGGGGGGAGGGGG - Intergenic
1130264696 15:82389813-82389835 TGTTGTGGGGTGGGGGGGAGGGG - Intergenic
1130303531 15:82698363-82698385 TATAAGAGGGTGTGGGAGAGTGG - Intronic
1130303544 15:82698439-82698461 TCTATGAGGGTGTGGGGGAGCGG - Intronic
1130698317 15:86153504-86153526 TGTCGTGGGGTGGGGGGCAGGGG + Intronic
1130754426 15:86747624-86747646 TGTTGTGGGGTGTGGGGAGGAGG - Intronic
1130840779 15:87698841-87698863 TGTCGTGGGGTGGGGGGCAGGGG + Intergenic
1130910377 15:88266447-88266469 TGCGGTGGGGTGTGGGTGAGGGG + Intergenic
1131007980 15:88994083-88994105 TGTAGGGGGGTGTGGGGGTGGGG - Intergenic
1131286235 15:91060691-91060713 TGTCGTGGGGTGGGGGGGGGAGG + Intergenic
1131298766 15:91176035-91176057 TGTTGTGGGGTGGGGGGAAGGGG - Intronic
1131345322 15:91642357-91642379 TGTTGTGGGGTGGGGGGCAGGGG - Intergenic
1131415321 15:92250925-92250947 TGTTGTGGGGTGGGGGGAAGGGG - Intergenic
1131471488 15:92701348-92701370 TGTTGTGGGGTGCGGGGAAGGGG + Intronic
1131498067 15:92932439-92932461 TGTCATGGGGTGGGGGGGAGGGG - Intronic
1131547968 15:93331831-93331853 TGCACTTGGCTGTGGGGGAGGGG + Intergenic
1131568924 15:93512683-93512705 GGTAGTAGGGACTGGGGGAACGG + Intergenic
1131814297 15:96206417-96206439 TGTTGTGGAGTGGGGGGGAGGGG + Intergenic
1131996737 15:98140577-98140599 TGTAGGAGGGTAGGGGGGAAAGG - Intergenic
1132139167 15:99376690-99376712 TGTTGTGGGGTGGGGGGAAGTGG - Intronic
1132260771 15:100422930-100422952 TGTTGTGGGGTGGGGGGGAGGGG + Intronic
1132446496 15:101926132-101926154 TGTTGTGGGGTGGGGGGAAGGGG - Intergenic
1132912566 16:2322526-2322548 TGTTGTGGGGTGGGGGGGCGGGG - Intronic
1132931608 16:2461627-2461649 TGGGGTCGGGTGTGGGAGAGGGG + Intronic
1133527824 16:6623590-6623612 TGTTGTGGGGTGTGGGGCAGGGG - Intronic
1133558112 16:6924828-6924850 TGGGGTAGGGGGAGGGGGAGGGG - Intronic
1133642388 16:7729749-7729771 TGTTGTGGGGTGGGGGGAAGGGG + Intergenic
1133912569 16:10079185-10079207 TCTAGTAGGGACTGGAGGAGAGG + Intronic
1134005988 16:10819044-10819066 TGTCGTGGGGGGTGGGGGCGCGG - Intergenic
1134083540 16:11340910-11340932 TGGATTGTGGTGTGGGGGAGGGG + Intronic
1134617667 16:15664117-15664139 TGGTGGAGGGAGTGGGGGAGTGG - Intronic
1134875533 16:17695224-17695246 TCTACTAGGCGGTGGGGGAGTGG - Intergenic
1135924919 16:26685201-26685223 TGTTGTAGGGTGGGGGGGGGGGG - Intergenic
1136115018 16:28089038-28089060 TGTGGGGGGGTGTGGGGGTGTGG - Intergenic
1136141408 16:28291352-28291374 TGTTGTGGGGTGGGGGGAAGGGG + Intergenic
1136544434 16:30947669-30947691 TGGAGTGGGGGGTGGGGGTGGGG + Exonic
1136908389 16:34124464-34124486 TGTTGTGGGGTGTGGGAGGGGGG - Intergenic
1137064446 16:35825500-35825522 TGTTGTGGGGTGTGGGGGAGAGG - Intergenic
1137228806 16:46541343-46541365 TGTTGTGGGGTGGGGGGGAGGGG + Intergenic
1137267414 16:46880666-46880688 TGGACCAGGGTGTGGGGGATGGG - Intergenic
1137412671 16:48242891-48242913 TGTCGTTGGGTGGTGGGGAGTGG + Intronic
1137668932 16:50267976-50267998 TGGTGCAGAGTGTGGGGGAGGGG + Intronic
1137894727 16:52199020-52199042 TGTTGTGGGGTGTGGGTGACAGG + Intergenic
1138448163 16:57077658-57077680 TGTGCTGGGGTGTCGGGGAGAGG + Intronic
1138474317 16:57261811-57261833 AGTGGCAGGGTGTGGGGGGGTGG - Intronic
1138762274 16:59559438-59559460 TGTTGTGGGGTGGGGGGAAGGGG - Intergenic
1138790858 16:59902479-59902501 TGTTGTAGGGTGGGGGGAGGGGG + Intergenic
1138839920 16:60487891-60487913 GGTGGTAAGGTGTGGGGGGGAGG - Intergenic
1138916244 16:61468142-61468164 TGTAGTATGGTGTGTGGTTGTGG - Intergenic
1139072035 16:63393938-63393960 TGTTGTGGGGTGTGGGGAGGGGG + Intergenic
1139131335 16:64149561-64149583 TGTTGTGGGGTGTGGGGAGGGGG + Intergenic
1139469718 16:67171570-67171592 GGCAGTGGGGTGTGGGGGGGAGG + Intronic
1139652498 16:68369488-68369510 TGTAGTAGGGTGGGAGTGAGGGG + Intronic
1139791339 16:69439136-69439158 TGTAATATGGTGTGGGGTAGGGG + Intronic
1139939742 16:70596624-70596646 TTTGGCAGGGTGTGGGGGACGGG - Intronic
1139996502 16:70985950-70985972 TGTTGTGGGGTCGGGGGGAGGGG + Intronic
1140238222 16:73178109-73178131 TGAAGGATGGTGTGTGGGAGAGG - Intergenic
1140603280 16:76503674-76503696 TGTTGTGGGGTGGGGGGAAGGGG - Intronic
1140610793 16:76596737-76596759 TGTTGTGGGGTGGTGGGGAGTGG - Intronic
1140694968 16:77523760-77523782 TGTTGTGGGGTAGGGGGGAGCGG + Intergenic
1140864973 16:79052185-79052207 TGTGGTGGGGTGGGGGGAAGGGG - Intronic
1141601197 16:85127263-85127285 TGGGGTAGGGAGCGGGGGAGGGG + Intergenic
1142183118 16:88681304-88681326 TGTGGTAGGGTTTGTGGCAGTGG + Exonic
1142369668 16:89671552-89671574 TGTCGTGGGGTAGGGGGGAGGGG - Intergenic
1143078642 17:4365975-4365997 TGTAGGACGTTGCGGGGGAGGGG - Intronic
1143281038 17:5754169-5754191 TGGACTGGGGGGTGGGGGAGGGG + Intergenic
1143598246 17:7928582-7928604 TGAAGTAGGGGGTAGAGGAGGGG - Intronic
1144045011 17:11447580-11447602 TTTAGCTGGGTGTGGGGTAGAGG - Intronic
1144200476 17:12937004-12937026 TGTGGTAAGGTGTGGGAGAAGGG + Intronic
1146242169 17:31240214-31240236 TGTAGTGGGGGGTGGGGAAGGGG - Intronic
1146698350 17:34929940-34929962 TGGAGCAGGTTGTGGGTGAGAGG - Intronic
1147159180 17:38560686-38560708 TGTGGAATGGTTTGGGGGAGGGG - Intronic
1147612717 17:41811292-41811314 GGGGGTAGGGGGTGGGGGAGCGG + Intronic
1147718928 17:42526334-42526356 TGTGGTAGGGGGTGGGGAACAGG + Intergenic
1149458729 17:56810416-56810438 TGTATGAGGGTGTGTGTGAGGGG - Intronic
1149639046 17:58191434-58191456 TTCGGTAGGGTGTGGGGGTGGGG + Intergenic
1149946711 17:60936004-60936026 TGTTGTGGGGTGGGGGGAAGGGG - Intronic
1150340955 17:64366819-64366841 TGTAGTGGGGTGGGGGGAGGGGG + Intronic
1150365288 17:64577399-64577421 TGTTGTGGGGTGGGGGGAAGGGG + Intronic
1151334144 17:73430220-73430242 TGGAGGAGGGGGTGAGGGAGGGG - Intronic
1151406021 17:73886905-73886927 GGTGGTTGTGTGTGGGGGAGGGG + Intergenic
1151519626 17:74618832-74618854 TGGAGCAGGGTTTGGGGTAGGGG - Intronic
1152232942 17:79123998-79124020 TGCAGTAGAGTGTGTGGGAGGGG - Intronic
1152884918 17:82844169-82844191 TTTAGTGGGGAGTGGAGGAGTGG + Intronic
1152893459 17:82896089-82896111 TGAAGAAGGGGGTGTGGGAGGGG - Intronic
1153161559 18:2210395-2210417 TGTTGTGTGGTGGGGGGGAGGGG + Intergenic
1153195996 18:2597021-2597043 TGTTGTGGGGTGGGGGAGAGGGG + Intronic
1153408457 18:4766761-4766783 TGTTGTGGGGTGGGGGGGAGGGG + Intergenic
1153464368 18:5372643-5372665 TGTTGTGGGGTGGGGGAGAGGGG + Intergenic
1153714101 18:7828402-7828424 TGTTGTGGGGTGGGGGGAAGCGG - Intronic
1153755663 18:8280398-8280420 TGTGGTCGGGGGTGGGGGGGGGG + Intronic
1153913994 18:9729647-9729669 TTTAGAGGGGGGTGGGGGAGGGG - Intronic
1153956737 18:10102624-10102646 GGGAGTGGGGTGTTGGGGAGTGG + Intergenic
1154469652 18:14687099-14687121 TGTTGTGGGGTGTGGGGAGGGGG - Intergenic
1154480455 18:14818507-14818529 TGTTGTAGGGTGGGGGGAGGGGG - Intronic
1155248772 18:23936383-23936405 TGTAGTGGGGTGGGGGAGGGGGG - Intronic
1155414926 18:25587465-25587487 TGTAGTGGGGTGAGGAGGGGAGG + Intergenic
1155493710 18:26423092-26423114 TGTAGCATGGTGTGGGGATGGGG + Intergenic
1155567954 18:27158250-27158272 TGTTGTGGGGTGGGGGGAAGGGG - Intronic
1155658664 18:28222123-28222145 TGTTGTGGGGTGTGGGGCAGGGG - Intergenic
1155668680 18:28343024-28343046 TGTTGTGGGGTGGCGGGGAGAGG + Intergenic
1156002536 18:32401170-32401192 TGTCGTGGGGTTGGGGGGAGAGG + Intronic
1156053670 18:32971169-32971191 TGTAGTGGGGTGGGGGGTAAGGG - Intronic
1156094803 18:33516516-33516538 TGTGGTAAGGTGAGGGGGAGAGG - Intergenic
1156100020 18:33581990-33582012 TGCAGAAGGCTGTGGGGGAGGGG - Intronic
1156288487 18:35722673-35722695 TGTCGTGGGGTGGGGGGAAGAGG - Intergenic
1157279335 18:46335329-46335351 TGTAGCAGAATGTGAGGGAGAGG - Intronic
1157304567 18:46507702-46507724 TTCAGTAGGATCTGGGGGAGAGG + Exonic
1157440259 18:47706048-47706070 TGTTGTGGGGTGGGGGGGGGAGG + Intergenic
1157650879 18:49329279-49329301 TGTTGTGGGGTGGGGGGGAGGGG + Intronic
1158153533 18:54399875-54399897 TGTTGTGGGGTGGGGGGAAGGGG - Intergenic
1158166362 18:54545597-54545619 TGTAGTGGGTGGTGGGGGATGGG + Intergenic
1158234699 18:55300417-55300439 GGGAGTTGGGGGTGGGGGAGGGG + Intronic
1158372709 18:56827564-56827586 GGTAGTGGGGGTTGGGGGAGGGG + Intronic
1158476941 18:57788656-57788678 GGAAGCAGGGTTTGGGGGAGTGG - Intronic
1158599347 18:58843774-58843796 GGAAGCAGGGTGTGGGAGAGTGG - Intergenic
1158762097 18:60402188-60402210 TGTCGTGGGGTGGGGGGAAGGGG - Intergenic
1158764283 18:60430574-60430596 TGTTGTGGGGTGTGGGGAGGGGG - Intergenic
1158764516 18:60432853-60432875 TGTTGTGGGGTGTGGGGAGGGGG + Intergenic
1158766225 18:60454165-60454187 TGTTGTGGGGTGTGGGGAGGGGG - Intergenic
1158812202 18:61050859-61050881 TGTTGTGGGGTGGGGGGAAGGGG - Intergenic
1158908330 18:62035672-62035694 TGTTGTGGGGTGGGGGGAAGGGG - Intergenic
1158926626 18:62270790-62270812 TGTTGTGGGGTGGGGGGCAGGGG - Intronic
1159209220 18:65295226-65295248 TGTTGTGGGGTGTGGGGACGGGG - Intergenic
1159311991 18:66720940-66720962 TGTTGTGGGGTGAGGGGAAGGGG + Intergenic
1159419698 18:68201623-68201645 TGTTGTGGGGTGTGGGGAGGGGG + Intergenic
1159427321 18:68306339-68306361 TGTTGTAGGGTGGGGGGATGGGG + Intergenic
1159660717 18:71092971-71092993 TGTTGTGGGGTGGGGGGAAGGGG - Intergenic
1160056158 18:75482901-75482923 GGTGGTAAGGTGTGGGGGGGAGG - Intergenic
1160275775 18:77433661-77433683 TGACGTGGGGTGAGGGGGAGGGG - Intergenic
1160543116 18:79636141-79636163 TGTTGTGGGGTGGGGGGGAGGGG - Intergenic
1160607291 18:80061134-80061156 TGTCATGGGGTGTGGGGCAGGGG - Intronic
1160638722 19:106087-106109 TGTTGTGGGGTGGGGGGAAGGGG + Intergenic
1161258631 19:3323397-3323419 TGTGGTGGGGTGTGGGGCGGGGG - Intergenic
1162145971 19:8612077-8612099 TGGAGTAGGGGGTGGAGGAGGGG + Intergenic
1162216305 19:9136820-9136842 TGTTGTAGGGTGGGGGGAGGGGG + Intergenic
1162345481 19:10115812-10115834 TGTCGTCGGCTGTGTGGGAGAGG + Exonic
1162393406 19:10403167-10403189 CGGAGCAGGGAGTGGGGGAGCGG + Intronic
1163088357 19:14999992-15000014 TGTTGTGGGGTGGGGGGGAGGGG - Intronic
1163166048 19:15499007-15499029 TGCAGTAGGGGGTGGGGGTGGGG + Intergenic
1163283269 19:16330394-16330416 TATGGCAGGGGGTGGGGGAGAGG + Intergenic
1163883532 19:19947169-19947191 TGTAGTAGGTTGTGTTGGAAGGG - Intergenic
1164132424 19:22377245-22377267 TGTTGTGGGGTGTGGGGAAGGGG - Intergenic
1164220276 19:23187228-23187250 TGGGGTAGGGGGTGGGGGGGGGG - Intergenic
1165270262 19:34700526-34700548 TGTTGTGGGGTGGGGGAGAGGGG - Intergenic
1165610306 19:37146049-37146071 TGGAGTAGAGTGTGGTGGGGAGG + Intronic
1165745359 19:38227465-38227487 TGTAGGAGAGTATGTGGGAGTGG - Intronic
1165845133 19:38813124-38813146 TGCAGGAGGGCGTAGGGGAGGGG - Exonic
1166109318 19:40612981-40613003 TGGAGTAGGGTGTCTGGGGGAGG - Intronic
1166846427 19:45731191-45731213 TGCAATAGGGTGTTGGTGAGGGG + Intergenic
1167169045 19:47818889-47818911 TGTTGTGGGGTGGGGGGCAGGGG - Intronic
1167968513 19:53169679-53169701 TGTTGTGGGGTGGGGGGAAGGGG - Intronic
1168162141 19:54517957-54517979 TGGGGTCGGGGGTGGGGGAGGGG + Intergenic
1168370386 19:55828261-55828283 TGTGGTGGGGTGGGGGGAAGGGG + Intronic
1168389611 19:55995204-55995226 TGTCCTAGGGTGTGGGGCTGGGG + Intergenic
1202675077 1_KI270710v1_random:35974-35996 TGTAGTGGGGTGGGGGGAGGGGG + Intergenic
1202684374 1_KI270712v1_random:35768-35790 TGTTGTGGGGTGTGGGGAGGGGG + Intergenic
925043695 2:754359-754381 TGTGGTGGGGTGGGGGGAAGGGG + Intergenic
925420142 2:3704357-3704379 TGGAGGAGGGCGTGGGGGAGGGG + Intronic
925420169 2:3704416-3704438 TGGAGAGGGGCGTGGGGGAGGGG + Intronic
925420231 2:3704555-3704577 TGGAGGAGGGCATGGGGGAGGGG + Intronic
925420258 2:3704614-3704636 TGGAGAGGGGCGTGGGGGAGGGG + Intronic
925424216 2:3735409-3735431 TGTTGTGGGGTGGGGGGCAGGGG - Intronic
926003102 2:9350190-9350212 TGGTGTCGTGTGTGGGGGAGAGG + Intronic
926105104 2:10145041-10145063 TGTAGGAGTCTGTGGGAGAGTGG + Intronic
926152856 2:10434505-10434527 TGTGGTAGTGTGTGGGGGATGGG + Intergenic
926165861 2:10521933-10521955 TGTGACTGGGTGTGGGGGAGGGG + Intergenic
926308479 2:11657508-11657530 GGGAGTAGGGGGTGGGGGACGGG + Intergenic
926347475 2:11961309-11961331 TGTAGGAGGGTGGGGGTGTGAGG + Intergenic
926355729 2:12039036-12039058 TGTAGTTGGGTGGGGGGCTGAGG + Intergenic
926513365 2:13809899-13809921 TGTTGTGGGGTGGGGGGAAGGGG + Intergenic
926755328 2:16230282-16230304 TGTTGTGGGGTGGGGGGAAGGGG - Intergenic
926917158 2:17903603-17903625 TGTTGTGGGGTGGGGGGAAGGGG - Intronic
926943418 2:18162362-18162384 TGTCGTGGGGTGGGGGGTAGGGG - Intronic
927282709 2:21324515-21324537 TGTCGTGGGGTGGCGGGGAGTGG - Intergenic
928082799 2:28325706-28325728 TGTTTGAGGATGTGGGGGAGGGG - Intronic
928246929 2:29638509-29638531 TGGAGTAGGGTGGGGGTGGGGGG + Intronic
928250367 2:29672322-29672344 TGTTGTGGGGTGGGGGGAAGGGG - Intronic
928381123 2:30819660-30819682 TGTTGTGGGGTGGGGGGGAGCGG + Intronic
928845776 2:35670072-35670094 TGTTGTAGGGTGGGGGGAGGGGG - Intergenic
928881625 2:36102980-36103002 TGTTGTGGGGTGGGGGGAAGGGG + Intergenic
929012014 2:37454222-37454244 TGTTGTGGGGTGCGGGGAAGGGG - Intergenic
929082245 2:38132554-38132576 TGTTGTGGGGTGTGGGGAGGGGG - Intergenic
929089337 2:38199326-38199348 TGCAGTGGGGTGTGGCTGAGAGG - Intergenic
929317160 2:40493340-40493362 TGTTGTGGGGTGGGGGGGAGGGG + Intronic
929740279 2:44592058-44592080 TGTTGTGGGGTGGGGGGAAGGGG + Intronic
929844045 2:45502676-45502698 TGTCGTGGGGTGGGGGGAAGGGG + Intronic
929998868 2:46847547-46847569 AGGAGTGGGGTGAGGGGGAGAGG + Intronic
930025553 2:47027173-47027195 AGCAGCAGTGTGTGGGGGAGAGG + Intronic
930290433 2:49486315-49486337 TGTTGTGGGGTGGGGGGGAGGGG + Intergenic
930596933 2:53400671-53400693 TGTGGTGGGGTCGGGGGGAGGGG + Intergenic
931021960 2:58056084-58056106 TCTTTTAGGGGGTGGGGGAGGGG - Intronic
931032050 2:58187410-58187432 TGTCGTGGGGTGGGGGGGATGGG + Intronic
931115451 2:59162055-59162077 TGTGGTGGGGTGGGGGGGAGGGG - Intergenic
931243703 2:60475719-60475741 TGTAGTGGGGGCAGGGGGAGGGG + Intronic
931846786 2:66212211-66212233 TGTTGTGGGGTGGGGGGGAGGGG + Intergenic
931885910 2:66617246-66617268 TGTCGTGGGGTGGGGGGCAGGGG - Intergenic
932431012 2:71673490-71673512 TGAAGTTGGGTGGGGTGGAGAGG + Intronic
932501390 2:72185888-72185910 TGTCGTGGGGTTGGGGGGAGGGG - Intronic
932640586 2:73441479-73441501 TGGAGTAGGGTGTGGGGAGATGG + Intronic
932887566 2:75561011-75561033 TGCAGAAGGGGGCGGGGGAGAGG - Intronic
932988859 2:76762048-76762070 TGTAGTTGGGGGTGAGTGAGTGG - Intronic
933360164 2:81271602-81271624 TGTTGTGGGGTGGGGGGAAGGGG - Intergenic
933680276 2:85093858-85093880 TGTTGTGGGGTGGGGGGAAGGGG - Intergenic
934247344 2:90319078-90319100 TGTTGTGGGGTGTGGGGAGGGGG - Intergenic
934261981 2:91483525-91483547 TGTTGTGGGGTGTGGGGAGGGGG + Intergenic
934532281 2:95100187-95100209 AGTAGTAGGGTTTGGAGGAGTGG - Intronic
934729781 2:96649335-96649357 TGCAGGAGGGTGGGGAGGAGAGG - Intergenic
934998261 2:98987245-98987267 TGTTGTGGGGTGGGGGGCAGGGG - Intergenic
935493280 2:103746834-103746856 TGTTTTGGGGTGGGGGGGAGGGG - Intergenic
936340913 2:111631965-111631987 TGTAGTGGGGTTGTGGGGAGAGG - Intergenic
936577287 2:113667632-113667654 TGTAGGTGGGGGTGGGGGTGGGG + Intergenic
937546659 2:123030363-123030385 TGTTGTGGGGTGGGGGGGAGTGG + Intergenic
937592854 2:123634576-123634598 TGTTGTAGGGTGGGGGGAGGCGG + Intergenic
937599025 2:123706347-123706369 TGTGGTGGGGTGGGGGGAAGGGG + Intergenic
937645216 2:124259003-124259025 TGTTGTAGGGTGGGGGGAGGGGG - Intronic
937911195 2:127076375-127076397 GGTAGTTGGGGGAGGGGGAGGGG - Intronic
938191766 2:129289557-129289579 TGTTGTGGGGTGGGGAGGAGGGG - Intergenic
938403376 2:131012573-131012595 TGTGTTGGGGGGTGGGGGAGGGG + Intronic
938485535 2:131703276-131703298 TGTTGTAGGGTGGGGGGAGGGGG + Intergenic
938494466 2:131786241-131786263 TTTTGTAGGGTGGTGGGGAGTGG - Intergenic
938782240 2:134595260-134595282 TGTTGTGGGGTTGGGGGGAGTGG - Intronic
938886213 2:135651872-135651894 TGGAGGAGGATGTGGTGGAGGGG - Exonic
938916181 2:135942499-135942521 TGTAGTGGGGTGGGGGGAGGGGG + Intronic
938980992 2:136526929-136526951 TGCCAGAGGGTGTGGGGGAGAGG + Intergenic
939038943 2:137164875-137164897 TGTCGTGGGGTGGGGGAGAGGGG + Intronic
939261811 2:139820431-139820453 TGTTGTGGGGTGGGGGGGAGGGG - Intergenic
939548291 2:143581393-143581415 TGTAGGTGGGTGTGGGGCTGTGG - Intronic
939771969 2:146332854-146332876 TGTTGTGGGGTGGGGGGAAGGGG - Intergenic
939845077 2:147233199-147233221 TGTTGTGGGGTGGGGGGAAGTGG + Intergenic
940082675 2:149822108-149822130 TGTTGTAGGGTGGGGGGAGGGGG + Intergenic
940120566 2:150260087-150260109 TGGAGTAGGGTTTGGGTAAGAGG - Intergenic
940468479 2:154063062-154063084 TACAGAAGGGTGTTGGGGAGAGG + Intronic
940536700 2:154954791-154954813 TGTTGTGGGGTGTGGGGAGGGGG - Intergenic
940539176 2:154988813-154988835 TGTTGTGGGGTGTGGGGAGGGGG - Intergenic
940574290 2:155479781-155479803 TGTTGTGGGGTGGAGGGGAGGGG + Intergenic
940659013 2:156523548-156523570 TATAGTGGGGAGTGGGGGAAAGG - Intronic
940809725 2:158228803-158228825 TGTTGTGGGGTTGGGGGGAGGGG + Intronic
940994784 2:160136896-160136918 TGTTGTGGGGTGGGGGGAAGGGG + Intronic
941134351 2:161696059-161696081 TGTCGTGGGGTGGGGGGAAGTGG - Intronic
941566445 2:167114591-167114613 TGTTGTGGGGTGGGGGGAAGGGG - Intronic
941589554 2:167402956-167402978 TGCAATCGGGGGTGGGGGAGTGG - Intergenic
941589581 2:167403168-167403190 TGTAGTGGGGTGGGGGGAGGGGG - Intergenic
942633723 2:177978921-177978943 TGTGGTGGGGTCGGGGGGAGGGG + Intronic
942960082 2:181819877-181819899 TGTGGGAGGGTGTTGAGGAGGGG + Intergenic
943713269 2:191121766-191121788 TGTTGTGGGGTGGGGGGAAGGGG + Intronic
943874093 2:193039873-193039895 TGTTGTAGGGTGGGGGGAGGGGG + Intergenic
944193607 2:197029125-197029147 TGTTGTGGGGTGGGGGGAAGGGG - Intronic
944339119 2:198574869-198574891 TGTTGTGGGGTGTGGGGAGGGGG - Intergenic
945143377 2:206711731-206711753 TGTTGTGGGGTGGGGGGAAGGGG - Intronic
945350748 2:208776129-208776151 TGTTGTGGGGTGGGGGGAAGGGG + Intronic
945380531 2:209134390-209134412 TGTGGTGGGGTGTGGGGAGGGGG + Intergenic
945719518 2:213402572-213402594 TGTTGTGGGGTGTGGGGAGGGGG - Intronic
946778564 2:223169630-223169652 TGTTGTGGGGTGGGGGGAAGGGG + Intronic
946938315 2:224744677-224744699 TGTTGTGGGGTGGGGGGAAGAGG - Intergenic
947272974 2:228359114-228359136 TGTTGTGGGGTGGGGGGAAGGGG - Intergenic
947305486 2:228741562-228741584 TGTGGTGGGGTTGGGGGGAGGGG - Intergenic
947309734 2:228788112-228788134 TTGAGTAGGCTGTGGAGGAGGGG - Intergenic
947323492 2:228948826-228948848 TGTTGTGGGGTGGGGGGGAGGGG + Intronic
947388232 2:229614021-229614043 TGTTGTGGGGTGGGGGGGAGCGG + Intronic
947400807 2:229729792-229729814 TGTTGTAGGGTGGGGGGAGGGGG + Intergenic
948026969 2:234786109-234786131 TGCAATGGGGGGTGGGGGAGAGG - Intergenic
948210536 2:236189944-236189966 TATAGTAGGGTGGGGTGGAAGGG + Intergenic
948549209 2:238758014-238758036 TGTTGTGGGGTGGGGGGGGGAGG - Intergenic
948720839 2:239899083-239899105 TGTGGAGGGGTGTGGTGGAGGGG + Intronic
948720876 2:239899210-239899232 TGTGGAGGGGTGTGGTGGAGGGG + Intronic
948720922 2:239899376-239899398 TGTGGAGGGGTGTGGTGGAGAGG + Intronic
1168735876 20:135825-135847 TGTGGTGGGGTGTGGGGAGGGGG + Intergenic
1169185752 20:3615888-3615910 TGTTGTGGGGTGGGGGGAAGGGG + Intronic
1169527869 20:6449960-6449982 TGTTGGAGGGTGTGGGGCAAGGG - Intergenic
1169530776 20:6482609-6482631 TGAAGTGGGGTGGAGGGGAGTGG - Intergenic
1169544492 20:6636782-6636804 TGTACTGGGGTGGTGGGGAGGGG + Intergenic
1169558222 20:6770481-6770503 TGGAGCAGGGCGTGGGGGCGGGG + Intronic
1169900835 20:10550425-10550447 TGTGGTTGGGTGTGAGGGAGAGG - Intronic
1170070352 20:12359709-12359731 TGTTGTGGGGTGGGGGGAAGGGG - Intergenic
1170247353 20:14237689-14237711 TGTTTTGGGGTGGGGGGGAGGGG - Intronic
1170386221 20:15820194-15820216 AGGAGTAGGGGGTGGGGGCGAGG + Intronic
1170673116 20:18453442-18453464 AGTTGTAGGGTTTGGGGGAAGGG - Intronic
1170721340 20:18882260-18882282 GGTGGTAAGGTGTGGGGGAAGGG + Intergenic
1170862079 20:20115574-20115596 TGGAGTGGGGTGGGGAGGAGAGG - Intronic
1170883086 20:20314682-20314704 TGTTGTGGGGTGGGGGGGTGGGG - Intronic
1171137621 20:22711011-22711033 GGTGGTAAGGTGTGGGGGAAGGG + Intergenic
1171208957 20:23302435-23302457 GGTGGTAGGGAGTGGGGGCGGGG - Intergenic
1171740606 20:28881017-28881039 TGTTGTGGGGTGGGGGGAAGGGG + Intergenic
1171763845 20:29238324-29238346 TGTTGTGGGGTGGGGGGAAGGGG + Intergenic
1171842356 20:30230152-30230174 TGTCGTGGGGTAGGGGGGAGGGG - Intergenic
1171872066 20:30536457-30536479 TGTTGTAGGGTGGAGGGAAGGGG - Intergenic
1171983473 20:31643376-31643398 GGCAGTTGGGTGTGGGGAAGGGG - Intronic
1171986323 20:31664044-31664066 TGCTGTAGGGTGTGGGGGAAAGG - Intergenic
1172255012 20:33509966-33509988 TGTGGTGGGGTGGGGGGCAGGGG - Intronic
1173321242 20:41989237-41989259 GGGAGTGGGGTGTAGGGGAGGGG - Intergenic
1173356836 20:42300953-42300975 TGTTGTTGGGTGGGGGGAAGGGG + Intronic
1173477491 20:43371572-43371594 TGTTGTGGGGTGTGGGGAGGGGG + Intergenic
1173914092 20:46693652-46693674 TGTAGTAGAGTGGGGGTGGGAGG + Intergenic
1173969184 20:47137984-47138006 TGTTGTGGGGTGTGGGGAGGGGG + Intronic
1174116460 20:48229813-48229835 TGAAGTACAGTGTGGAGGAGGGG - Intergenic
1174240826 20:49133407-49133429 TTTTGCAGGTTGTGGGGGAGGGG - Intronic
1174695106 20:52549266-52549288 TGTCGTAGGGTGGGGGGAGGGGG + Intergenic
1174791022 20:53478507-53478529 TGTTGTAGGGTGGGGGGAGGGGG + Intronic
1174902789 20:54518270-54518292 TGTTGTGGGGTGGGGGGAAGGGG - Intronic
1175367372 20:58465327-58465349 TGGAGGAGGGGGTGGGGGAAGGG + Intronic
1175367674 20:58467074-58467096 TGTGTTGGGGTGTGGGAGAGGGG - Intronic
1175501844 20:59456337-59456359 TGGAGAAGGGTGCTGGGGAGAGG - Intergenic
1175863672 20:62163388-62163410 GGTAGTTGGGTGTGGGAGGGAGG + Intronic
1175895733 20:62334859-62334881 TGTGCCAGGGTGTGGGAGAGGGG - Intronic
1176126812 20:63479209-63479231 TGCCGGAGGGTGTGGGGCAGCGG - Intergenic
1176428206 21:6561494-6561516 TGTGGTTGGGTGGGGGGGGGGGG - Intergenic
1176636127 21:9246363-9246385 TGGAGAAGGGTGTAGGGGAATGG + Intergenic
1176755298 21:10721387-10721409 TGAAGTGGAGTGTAGGGGAGTGG - Intergenic
1176755545 21:10722999-10723021 TGGAGTGGAGTGTAGGGGAGTGG - Intergenic
1176755595 21:10723284-10723306 TGTAGTAGAGTGGAGTGGAGTGG - Intergenic
1176761818 21:10804842-10804864 TGTTGTGGGGTGTGGGGAGGGGG + Intergenic
1176762004 21:10808493-10808515 TGTTGTGGGGTGGGGGGAAGGGG - Intergenic
1177062549 21:16393456-16393478 TGTTGTGGGGTGGGGGGAAGGGG - Intergenic
1177082951 21:16664696-16664718 TGTTGTGGGGTGGGGGGCAGGGG - Intergenic
1177533523 21:22395772-22395794 TGTTGTGGGGTGGGGGGAAGGGG + Intergenic
1177708233 21:24736977-24736999 TGTTGTGGGGTGGGGGGGAGGGG + Intergenic
1178251878 21:31011006-31011028 TGTATTGGGGTTGGGGGGAGGGG - Intergenic
1178414255 21:32391212-32391234 TGTTGTCGGGTCGGGGGGAGGGG + Intronic
1179293404 21:40039012-40039034 TGTAGTGGGGTGGGGGGAGGGGG + Intronic
1179379196 21:40882630-40882652 TGTAGTATGGTTTGTGGGATTGG + Intergenic
1179383104 21:40917700-40917722 TGTAGTGGGGTGGGGGGAGGGGG + Intergenic
1179533641 21:42037396-42037418 TGTTGTAAGGTGGGGGGAAGGGG + Intergenic
1180068724 21:45425512-45425534 TGCAGGAGGGTGTGGGTGAGTGG - Intronic
1180112152 21:45664763-45664785 TGTGGTGGGGTGGGGGGGAGGGG - Intronic
1180255469 21:46624418-46624440 GGTAGGAGAGTGTGGGGGATGGG + Intergenic
1180337247 22:11589163-11589185 TGTTGTGGGGTGTGGGAGGGGGG - Intergenic
1180371770 22:12044734-12044756 AGTTGTGGGGTGGGGGGGAGTGG + Intergenic
1180587744 22:16907950-16907972 TGTTGTGGGGTGTGGGGAGGGGG - Intergenic
1180780821 22:18518467-18518489 TGGAGTAGGGTGGGGAGAAGAGG + Intergenic
1180813534 22:18775774-18775796 TGGAGTAGGGTGGGGAGAAGAGG + Intergenic
1181073976 22:20362379-20362401 TGTTGTGGGGTGGGGGGGGGAGG + Intronic
1181100755 22:20537287-20537309 TGTCCTAGGGTGTAGGGGTGGGG + Intronic
1181199718 22:21210104-21210126 TGGAGTAGGGTGGGGAGAAGAGG + Intronic
1181681317 22:24497619-24497641 AGTAGCAGGGTGAGGGGTAGAGG + Intronic
1181938391 22:26455577-26455599 TGTTGTAGGGTGGGGGGAGGGGG + Intronic
1182089261 22:27583117-27583139 AAAAGTAGGGTGTGCGGGAGAGG + Intergenic
1182155776 22:28071577-28071599 TGTGGTGGGGTGGGGGGGAGCGG + Intronic
1182193735 22:28492105-28492127 TGTTGTGGGGTGGGGGGGAGCGG + Intronic
1182842947 22:33406681-33406703 TGTGGTGGTGTGTGGAGGAGTGG + Intronic
1183380781 22:37489531-37489553 TGGAGTAGGGGGTGGGGGGCAGG - Intergenic
1183872551 22:40751140-40751162 GGGAGTGGGGTGAGGGGGAGAGG + Intergenic
1183999267 22:41660453-41660475 TGAAGTGGGGTGTGGGTGGGAGG - Intronic
1184422828 22:44391740-44391762 TGCAGCAGGGAGTGGAGGAGAGG - Intergenic
1184908871 22:47512229-47512251 AATAATTGGGTGTGGGGGAGTGG + Intergenic
1184935446 22:47717151-47717173 TGTAGGGGGGGGTGGGGGTGGGG - Intergenic
1184951933 22:47849430-47849452 TGGACTAGGGTGAGGGGGGGTGG - Intergenic
1184988758 22:48153611-48153633 CGTAGTAGGGACTGGGGAAGGGG + Intergenic
1185212750 22:49580778-49580800 TGGTGTAGTGTGTGTGGGAGGGG - Intronic
1185239448 22:49734917-49734939 TGCAGGAGGGTGAGTGGGAGGGG - Intergenic
1185422941 22:50745032-50745054 TGTAGGTGGGGGTGGGGGTGGGG - Exonic
1203227117 22_KI270731v1_random:84815-84837 TGGAGTAGGGTGGGGAGAAGAGG - Intergenic
1203263634 22_KI270734v1_random:1456-1478 TGGAGTAGGGTGGGGAGAAGAGG + Intergenic
1203297316 22_KI270736v1_random:52381-52403 GGGAGTAGAGTGTGGTGGAGTGG + Intergenic
1203299580 22_KI270736v1_random:67633-67655 TGTAGGAGAGCGTGGTGGAGTGG + Intergenic
1203300361 22_KI270736v1_random:72882-72904 TGTAGTTGTGTGGAGGGGAGTGG + Intergenic
1203302295 22_KI270736v1_random:85566-85588 TGGAGTGGGGTGGGGTGGAGTGG + Intergenic
1203310148 22_KI270736v1_random:137103-137125 TGGAGTAGGGTGGAGTGGAGTGG + Intergenic
949215880 3:1566376-1566398 TGTTGTGGGGTGGGGGGGTGGGG + Intergenic
949268324 3:2186076-2186098 TGTTGTGGGGTGGGGGGAAGGGG - Intronic
949446303 3:4137467-4137489 TGTTGTGGGGTGGGGGGAAGGGG + Intronic
949447110 3:4146682-4146704 TGTTGTGGGGTGGGGGGAAGGGG - Intronic
949512879 3:4782126-4782148 TGGAGTAGGCTGTTGGGGACTGG + Intronic
949600290 3:5590951-5590973 TGTTGTGGGGTGGGGGGAAGGGG - Intergenic
949793275 3:7817154-7817176 TGTAATAGGGTAGGAGGGAGGGG - Intergenic
949968995 3:9386373-9386395 TGGAGTGGGGGGTGGGGGGGTGG - Exonic
950016173 3:9756690-9756712 AGAAGTAGGGTCTGAGGGAGAGG - Intronic
951150854 3:19288376-19288398 TGTTGTGGGGTGTGGGGACGGGG - Intronic
951291202 3:20874062-20874084 TGTTGTGGGGTTGGGGGGAGGGG - Intergenic
951355276 3:21659643-21659665 TGTGGTGGGGTGTTGGGAAGAGG - Intronic
951532925 3:23714544-23714566 TTTAGTAGGGTGTGGGGAGAGGG - Intergenic
951830159 3:26917609-26917631 TGTTGTCGGGTGGGGAGGAGGGG - Intergenic
951939797 3:28065103-28065125 TGTTGTCAGGTGGGGGGGAGTGG + Intergenic
952294053 3:32045674-32045696 AGAAGTAAGCTGTGGGGGAGGGG + Intronic
952672915 3:35993101-35993123 TGCAGTAGGGAATGGAGGAGTGG - Intergenic
952687638 3:36168282-36168304 TGTTGTGGGGTGGGGGGAAGGGG - Intergenic
952731419 3:36640471-36640493 TGGAAAAGGGTGTGGGGGAGAGG - Intergenic
952928583 3:38341513-38341535 TGTTGTGGGGTGGGGGGAAGGGG - Intergenic
953091412 3:39730119-39730141 TGTTGTGGGGTGGGGGTGAGGGG - Intergenic
953639722 3:44695181-44695203 TGTTGTGGGGTGAGGGGAAGGGG + Intergenic
953743513 3:45556238-45556260 TGTAGTAGCTTGTGGGGTTGTGG - Intronic
953935373 3:47037277-47037299 TGTTGTGGGGTGGGGGGGAGGGG - Intronic
954462080 3:50632961-50632983 TGGAGGAGGGTGTTGGGGACTGG + Intronic
954971693 3:54656667-54656689 GGTAGCAGGGTGTCAGGGAGTGG - Intronic
955117196 3:56017532-56017554 AGTACAAGGGTGTGGGTGAGAGG - Intronic
955234959 3:57131128-57131150 GGTAGGAGGGGGTGGGGGAGGGG - Intronic
955382592 3:58451915-58451937 TGTGGGAGGGTGTGGGGTAGAGG - Intergenic
955477593 3:59354928-59354950 TGTTGTGGGGTGGGGGGAAGGGG - Intergenic
955482218 3:59401447-59401469 TGTTGTAGGGTGTGGGGAGTTGG + Intergenic
956254025 3:67264661-67264683 TGTTGTGGGGTGGGGGGAAGGGG - Intergenic
956277250 3:67515959-67515981 TGAAGGAGAGAGTGGGGGAGGGG - Intronic
956354861 3:68379912-68379934 TGTTGTGGGGTGGGGGGAAGGGG - Intronic
956461302 3:69475352-69475374 TGTTGTGGGGTGGGGGGAAGGGG - Intronic
956544113 3:70380689-70380711 TGTTGTGGGGTAGGGGGGAGAGG - Intergenic
956861907 3:73332993-73333015 TGTTGTGGGGTGGGGGGGAGGGG - Intergenic
956947378 3:74238496-74238518 TGTTGTGGGGTGGGGGGAAGGGG - Intergenic
956976783 3:74589952-74589974 TGTTGTGGGGTGGGGGGGAGGGG + Intergenic
957009788 3:74990628-74990650 TGGAGTACGGGGTGTGGGAGGGG + Intergenic
957017978 3:75092127-75092149 TGTTGTGGGGTGTGGGGTGGGGG - Intergenic
957150316 3:76478174-76478196 TGTTGTGGGGTGGGGGGGAGGGG - Intronic
957206890 3:77210734-77210756 TGTTGTGGGGTGGGGGGAAGGGG - Intronic
957284141 3:78195570-78195592 TGTTGTGGGGTGGGGGGGAGAGG + Intergenic
957367301 3:79242979-79243001 TGTTGTGGGGTGGGGGGGAGGGG - Intronic
957473007 3:80683964-80683986 TGTTGTAGGGTGGGGGGAGGGGG - Intergenic
957791112 3:84942264-84942286 TGTAGTTGGGTGGGGGTCAGTGG - Intergenic
957801983 3:85097145-85097167 TGTTGTGGGGTGTGGGGAGGGGG - Intronic
957869973 3:86078839-86078861 TGTATTACAGTGTGGGGGTGGGG + Intergenic
957967258 3:87338182-87338204 TGTTGTGGGGTGTGGGGAGGGGG + Intergenic
957987289 3:87588637-87588659 TGTTGTGGGGTTGGGGGGAGCGG + Intergenic
958062564 3:88503242-88503264 TGTTGTGGGGTGGGGGGAAGGGG - Intergenic
958067425 3:88561140-88561162 TGTTGTGGGGTGGGGGGAAGGGG + Intergenic
958107657 3:89098224-89098246 TGTTGTAGGGTGGGGGAGGGGGG - Intergenic
958184618 3:90105130-90105152 TGTTGTGGGGTGGGGGAGAGGGG - Intergenic
958186380 3:90125262-90125284 TGTTATGGGGTGGGGGGGAGGGG + Intergenic
958410229 3:93807159-93807181 TGTTGTGGGGTGTGGGGAGGGGG + Intergenic
958418370 3:93903961-93903983 TGTTGTAGGGTGGGGGGAGGGGG - Intronic
958635580 3:96739948-96739970 TGTTGTGGGGTGGGGGGGAGGGG + Intergenic
958655934 3:97003784-97003806 TGTTGTGGGGTGGGGGGGTGAGG - Intronic
958698297 3:97555076-97555098 TGTTGTGGGGTGGGGGGAAGGGG - Intronic
958815668 3:98911872-98911894 TGTCGGAGGGTGTGGGTGGGAGG + Intergenic
958885791 3:99725561-99725583 TGTTGTAGGGTGGGGGGAGGGGG - Intronic
958886500 3:99733294-99733316 TGTTGTGGGGTGTGGGGAGGGGG - Intronic
959028586 3:101271132-101271154 TCTTGTAGGGTGGTGGGGAGGGG + Intronic
959036270 3:101368570-101368592 TGTTGTAGGGTGGGGGGTGGGGG + Intronic
959097004 3:101967100-101967122 TGTCGTAGGGTGGGGGGCTGGGG - Intergenic
959119655 3:102217570-102217592 TGTTGTGGGGTGGGGGGGAGGGG + Intronic
959304419 3:104642458-104642480 TGTAGTGGGGCCTGGGGGAGAGG + Intergenic
959595684 3:108126169-108126191 TGTGGTGGGGTGTGGGTGACTGG + Intergenic
959744920 3:109765120-109765142 TGTTGTGGGGTGGGGGGAAGGGG + Intergenic
960108151 3:113819970-113819992 TGCAGTTGGGTGTGTGGGTGGGG - Intergenic
960196797 3:114778090-114778112 TGTTGTGGGGTGGGGGGAAGGGG + Intronic
960228770 3:115199173-115199195 TGTTGTAGGGTGGGGGGACGGGG + Intergenic
960338661 3:116448132-116448154 TGTGGTGGGGTGTGGGGAGGGGG - Intronic
960360096 3:116700374-116700396 TGTTGTGGGGTGGGGGGAAGGGG + Intronic
960404352 3:117240335-117240357 GGTAGTAGGGGGTAGGGTAGGGG + Intergenic
960456879 3:117883102-117883124 TGTTGTGGGGTTGGGGGGAGTGG + Intergenic
960515667 3:118599721-118599743 TGTGGTAGTGTGTGGGGTGGGGG - Intergenic
960565681 3:119129154-119129176 TGTTGTGGGGTGGGGGTGAGGGG + Intronic
960887278 3:122409012-122409034 TGTGGCGGGGGGTGGGGGAGCGG - Intronic
960912910 3:122667310-122667332 TGTCGTGGGGTGGGGGGCAGGGG - Intergenic
961422139 3:126814861-126814883 TGAAGTGGGGTGAGGGGGATGGG + Intronic
961732858 3:128979792-128979814 TGTTGTGGGGTGGGGGGAAGGGG + Intronic
961867828 3:129966830-129966852 TGAAGGTGGTTGTGGGGGAGTGG - Intergenic
962060971 3:131926961-131926983 AGAATTAGGGTGTGGGAGAGAGG + Intronic
962080012 3:132128397-132128419 TGTTGTGGGGTGGGGGGAAGGGG + Intronic
962127375 3:132634900-132634922 TGTTGTGGGGTGGGGGGGTGGGG + Intronic
962139692 3:132776110-132776132 GGTAGTGGGGGGTGGGAGAGAGG + Intergenic
962223460 3:133584234-133584256 TGTGGTAGGGTGAGGAGGAGAGG + Intronic
962466874 3:135668779-135668801 TGTTGTAGGGTGTGGGGACGGGG - Intergenic
962870542 3:139487191-139487213 TGTTGTGGGGTGTGGGGATGGGG - Intergenic
963396239 3:144738716-144738738 TGTTGTGGGGTGGGGGGAAGGGG - Intergenic
963706911 3:148698858-148698880 TGGAGTTGGGTGTCGGGCAGTGG - Intronic
964365822 3:155950013-155950035 TCGGGGAGGGTGTGGGGGAGGGG - Intergenic
964402064 3:156310310-156310332 TGCTGTAGGGTGTGGAGGAAGGG + Intronic
964455998 3:156866849-156866871 TAGAGTTGGGTGTGGGGAAGGGG - Intronic
964584664 3:158284038-158284060 TGTTGTGGGGTGGGGGGAAGGGG - Intronic
964645820 3:158957439-158957461 TGTGGTGGGGTGGGGGGGAGGGG - Intergenic
964923814 3:161931952-161931974 TGTTGTAGGGTCGGGGGAAGGGG - Intergenic
964943902 3:162194891-162194913 TGTGGTGGGGTGTGGGGAGGGGG + Intergenic
965018350 3:163191359-163191381 TGTTGTGGGGTGGGGGGGAGTGG - Intergenic
965223569 3:165958974-165958996 TGTTGTGGGGTGGGGGGAAGGGG - Intergenic
965238141 3:166155870-166155892 TGTTGTAGGGTGGGGGAGGGGGG - Intergenic
965680164 3:171242010-171242032 TGTTGTGGGGTGGGGGGAAGGGG + Intronic
965805947 3:172541868-172541890 TGTGGCAGGGTGTTGGAGAGGGG + Intergenic
966239599 3:177741939-177741961 TACAGTTGGGGGTGGGGGAGAGG - Intergenic
966448483 3:180030631-180030653 TTTAAGAGGGTGTGTGGGAGTGG + Intronic
966450612 3:180056041-180056063 TGTTGTAGGGTGGGGGGAGGGGG + Intergenic
966478772 3:180381470-180381492 TGTTGTGGGGTGGGGGGAAGGGG + Intergenic
966545589 3:181143001-181143023 TGTGGTAAGGTGTGGGAGAGGGG - Intergenic
966609193 3:181851414-181851436 AGGAGTAGGGAGTGGGGGTGGGG - Intergenic
966649598 3:182284830-182284852 TGTTTCAGGGTGTGGAGGAGAGG + Intergenic
966948625 3:184795991-184796013 TGGAGCAAGGTCTGGGGGAGGGG + Intergenic
967096115 3:186178651-186178673 TGCAGAAGGGAGTGGGAGAGGGG + Intronic
967157184 3:186704152-186704174 TCTAGGGGGGTGTGGGGGAAGGG - Intergenic
967438764 3:189481797-189481819 GGAAGTAAGGTGTGTGGGAGGGG - Intergenic
967478779 3:189950561-189950583 TGCACTGGAGTGTGGGGGAGTGG + Intergenic
967930397 3:194686673-194686695 TGTGGTAGGGAGTTGGGGGGAGG - Exonic
967931559 3:194694079-194694101 GGGAGTAGGGGGTGGGGGGGGGG - Intergenic
968005993 3:195243205-195243227 TGTCGTGGGGTGGGGGGAAGGGG + Intronic
968373375 4:15946-15968 TGTTGTGGGGTGGGGGGGAGGGG + Intergenic
968522517 4:1040354-1040376 TGTAGTTGTGTGTGGGGCTGGGG + Intergenic
968531385 4:1093785-1093807 TGGAGCAGGGTGAGGGGGTGAGG + Intronic
968560711 4:1279972-1279994 TGTCGTGGGGTGAGGGGGATGGG + Intergenic
968842931 4:3021357-3021379 AGTTGGAGGATGTGGGGGAGGGG - Intronic
969165908 4:5312433-5312455 TGTTGTGGGGTGTGGGGAGGGGG - Intronic
969308327 4:6338214-6338236 ATAATTAGGGTGTGGGGGAGTGG - Intronic
969511766 4:7622159-7622181 TGGAGTAGGGGCTGGGTGAGGGG - Intronic
969650524 4:8465062-8465084 TGGAGTGGGGAGTGAGGGAGAGG + Intronic
969905284 4:10387878-10387900 TGTTGTGGGGTGGGGGGAAGGGG + Intergenic
970473851 4:16402532-16402554 TGTTGTGGGGTGTGGGGAGGGGG - Intergenic
970688668 4:18597274-18597296 TGTTGTGGGGTGGGGGGAAGGGG - Intergenic
970692315 4:18633565-18633587 TGTAGTAGGATGTGGGCAAAGGG + Intergenic
970695903 4:18676709-18676731 TATTGTAAGGTGTGTGGGAGGGG + Intergenic
970780684 4:19734022-19734044 TGTTGTGGGGTGGGGGGAAGGGG + Intergenic
970908933 4:21251857-21251879 TGTGGTGGGGTGTGGGGAGGGGG + Intronic
970926459 4:21458139-21458161 TGTGGTAGGGTGGGGGGAGGGGG - Intronic
971165424 4:24177461-24177483 TGTTGTGGGGTGGGGGGAAGGGG + Intergenic
971363430 4:25957118-25957140 TGTTGTGGGGTGTGGGGAGGGGG + Intergenic
971537551 4:27772524-27772546 TGTTGTGGGGTTGGGGGGAGGGG + Intergenic
971567141 4:28159762-28159784 TGTTGTAGGGTGGGGGGAGGAGG + Intergenic
971653894 4:29316964-29316986 TGTTGTGGGGTGAGGGGCAGGGG - Intergenic
971726436 4:30318552-30318574 TGTCGTAGGGTGTGGGGAGGGGG + Intergenic
971920780 4:32936748-32936770 TGTGGTGGGGAGGGGGGGAGGGG - Intergenic
972030147 4:34444929-34444951 TGTTGTGGGGTGGGGGGAAGGGG + Intergenic
972222714 4:36974656-36974678 TGTTGTGGGGTGGGGGGGAGGGG - Intergenic
972710202 4:41588081-41588103 TGTTGTGGGGTGGGGGGAAGGGG - Intronic
972814240 4:42626556-42626578 TTTAGTATGGTGTGGAGGAATGG - Intronic
972868623 4:43267916-43267938 TGTCGTAGGGGGTGGGGGGCTGG - Intergenic
972916803 4:43891675-43891697 TGTTGTGGGGTGGGGGGCAGGGG - Intergenic
972928878 4:44046900-44046922 GGTAGTAGGGGTTGGGGAAGGGG + Intergenic
973085642 4:46055948-46055970 TGTGGTGGGGTCGGGGGGAGGGG + Intronic
973116244 4:46463866-46463888 TGTTGTGGGGTGGGGGGAAGGGG - Intronic
973126806 4:46595935-46595957 TGTTGTGGGGTGGGGGGAAGGGG + Intergenic
973133558 4:46677828-46677850 TGTTGTGGGGTGGGGGGAAGGGG - Intergenic
973328305 4:48886486-48886508 TGTTGTAGGGTGGGGGGAGGGGG - Intronic
973344476 4:49039891-49039913 TGTTGTGGGGTGTGGGGACGGGG - Intronic
973676888 4:53272696-53272718 TGTTGTGGGGTGGGGGGAAGGGG + Intronic
973682464 4:53334596-53334618 TGTGGTGGGGTGGGGGGAAGGGG + Intronic
973860666 4:55061622-55061644 TGTTGTGGGGTGGGGGGAAGGGG + Intergenic
974252877 4:59411853-59411875 TGTTGTGGGGTGTGGGGAGGGGG - Intergenic
974426559 4:61749704-61749726 TGTTGTAGGGTGGGGGGTGGAGG + Intronic
974477347 4:62400461-62400483 TGTAGTGGGGTGGGGGGAGGGGG - Intergenic
974632211 4:64507639-64507661 TGTCGTGGGGTGGGGGGAAGGGG + Intergenic
974710739 4:65591016-65591038 TGGAGTAGGGGGTTGGGGAAGGG - Intronic
974889498 4:67862902-67862924 TGTTGTGGGGTGGGGGAGAGGGG + Intronic
974997766 4:69183489-69183511 TGTTGTGGGGTGGGGGAGAGGGG - Intronic
975251455 4:72183896-72183918 TGTTGTGGGGTGGGGGGAAGGGG + Intergenic
975430560 4:74285185-74285207 TGTTGTGGGGTGAGGGGGATGGG + Intronic
975515305 4:75240832-75240854 TGTTGTGGGGTGGGGGGGAGGGG + Intergenic
975522996 4:75320148-75320170 TGTCGTGGGGTGGGGGAGAGGGG + Intergenic
975616995 4:76256530-76256552 TGTCCTAGGGTTTGTGGGAGGGG + Intronic
975722254 4:77259576-77259598 TGTTGTGGGGTGGGGGGGAAGGG + Intronic
975751751 4:77531270-77531292 TGTAGTGGGGTGGGGGGAGGGGG - Intronic
975767787 4:77687186-77687208 TGTTGTGGGGTGGGGGGGAGGGG + Intergenic
975794625 4:77994213-77994235 TGTTGTAGGTTGTGAGGGAGAGG + Intergenic
976049467 4:80994621-80994643 TGTTGTGGGGTGTGGGGAGGGGG - Intergenic
976107924 4:81639559-81639581 GGCAGCAGGGGGTGGGGGAGGGG + Intronic
976158201 4:82170572-82170594 TGTTGTGGGGTGGGGGGAAGGGG - Intergenic
976223246 4:82775043-82775065 AGTGGCAGGCTGTGGGGGAGAGG - Intronic
976573455 4:86639674-86639696 TGTTGTGGGGTGGGGGGAAGGGG + Intronic
976619108 4:87110501-87110523 GGTAGTAGGGGGTGGGGGGATGG - Intronic
976663484 4:87564973-87564995 TGTGGTGGGGTCGGGGGGAGGGG + Intergenic
977503106 4:97865701-97865723 TGGGGTAGGGTGAGGGGGAAGGG + Intronic
977711719 4:100134284-100134306 TGTTGTGGGGTGGGGGGCAGGGG - Intergenic
977822368 4:101489051-101489073 TGTGGTAAGCTGTGGGGGAATGG + Intronic
977873482 4:102122356-102122378 TGTTGTGGGGTGGGGGGAAGGGG - Intergenic
978156820 4:105499213-105499235 TGTGGTGGGGTGGGGGGAAGGGG - Intergenic
978471548 4:109073134-109073156 TGTATGTGTGTGTGGGGGAGGGG + Intronic
978476774 4:109139819-109139841 TGTTGTGGGGTCGGGGGGAGGGG - Intronic
978743379 4:112164109-112164131 TGTTGTGGGGTGGGGGGAAGGGG + Intronic
978744733 4:112179553-112179575 TGTAGTGGGGTGGGGAGAAGGGG + Intronic
978995579 4:115147094-115147116 TGTTGTGGGGTGTGGGGAGGGGG + Intergenic
979383266 4:120033640-120033662 TGTTGTGGGGTGGGGGGAAGGGG + Intergenic
979391113 4:120128773-120128795 TGTTGTGGGGTGGGGGGAAGGGG + Intergenic
979515486 4:121604820-121604842 TGTTGTGGGGTGGGGGAGAGGGG - Intergenic
979566945 4:122165218-122165240 TATCATAGGGTGCGGGGGAGAGG - Intronic
979686067 4:123511398-123511420 TGTCGTGGGGTGGGGGGAAGGGG - Intergenic
979820287 4:125162088-125162110 TGTCGTGGGGTGGGGGGAAGGGG - Intergenic
980533599 4:134086948-134086970 TGTTGTGGGGTGGGGGGAAGGGG - Intergenic
980589258 4:134863227-134863249 TGTAGTGGGGTGGGGGGAGGGGG - Intergenic
980607200 4:135108809-135108831 TGTTGTGGGGTGGGGGGGAGTGG - Intergenic
980795267 4:137674565-137674587 TGTTGTGGGGTGGGGGGAAGGGG - Intergenic
981319614 4:143376104-143376126 TGGTGTAGGGGGTTGGGGAGGGG - Intronic
981395031 4:144237520-144237542 TGTTGTGGGGTGTGGGGAGGGGG - Intergenic
981415532 4:144488406-144488428 TGTAGAAGGGTGGGGGGCTGGGG + Intergenic
981442949 4:144804055-144804077 TGTTGTGGGGTGGGGGGAAGAGG - Intergenic
981459902 4:145001029-145001051 TGTCGTAGGGTGCAGGGCAGGGG + Intronic
981645184 4:146991138-146991160 GGCAGTATGGTGTGGGGGCGGGG + Intergenic
981834765 4:149042200-149042222 TGTTGTGGGGTGGGGGGAAGGGG + Intergenic
981852069 4:149242690-149242712 TGTTGTGGGGTGGGGGGAAGGGG - Intergenic
982550824 4:156797335-156797357 TGAAGTGGGGTGTGGGCGAGGGG - Intronic
982621257 4:157708638-157708660 TGTTGTGGGGTGTGGGGAGGGGG + Intergenic
982666877 4:158276272-158276294 TGTTGTGGGGTGGGGGGAAGGGG - Intergenic
982802041 4:159717717-159717739 TGTTGTGGGGTGGGGGGAAGGGG + Intergenic
982872934 4:160607134-160607156 TGTAGTGGGGTGGGGGGGCAAGG + Intergenic
982873064 4:160608406-160608428 TGTTGTGGGGTGGGGGGAAGGGG - Intergenic
983377968 4:166953930-166953952 TGTTGTGGGGTGCTGGGGAGGGG + Intronic
984351137 4:178595347-178595369 TGTTGTGGGGTGGGGGGGAGCGG - Intergenic
984774100 4:183465840-183465862 TGAAGTATGGTGTGGGGTGGGGG + Intergenic
985066151 4:186124409-186124431 TGTTGTGGGGTGGGGGGGAGCGG - Intronic
985094246 4:186397390-186397412 TGTTGTGGGGTGGGGGGAAGGGG - Intergenic
985308278 4:188568349-188568371 TGTTGTGGGGTGGGAGGGAGTGG - Intergenic
985422558 4:189799109-189799131 TGTTGTGGGGTGGGGGGGAGGGG + Intergenic
1202751023 4_GL000008v2_random:4833-4855 TGGAGAAGGGTGTAGGGGAATGG + Intergenic
985517670 5:355259-355281 TGTGGTCTGGTGTGGTGGAGTGG + Intronic
985808198 5:2063763-2063785 TGTCACAGGGTGTGGGGGAAGGG + Intergenic
985896454 5:2752099-2752121 TGGAGAAGGGGGTGGGGGCGGGG - Intergenic
985929101 5:3042191-3042213 TGTTGTGGGGTGTGGAGGAAGGG + Intergenic
985961341 5:3305590-3305612 TGGAGGAGAGTGTGGGTGAGGGG + Intergenic
985974648 5:3407428-3407450 TGTTGTGGGGTGGGGGGAAGGGG - Intergenic
986177232 5:5363093-5363115 TGCAGTTGGGGGTGGGGGGGTGG - Intergenic
986323223 5:6650789-6650811 TGTTGTGGGGTGGGGGGGAGGGG - Intronic
986600295 5:9466214-9466236 TGTTGTGGGGTGAGGGGAAGGGG + Intronic
986611939 5:9577647-9577669 TGTTGTGGGGTGGGGGGAAGGGG + Intergenic
986799732 5:11246714-11246736 TGTAGGTGGGTGGGGGGGTGGGG + Intronic
986806931 5:11316637-11316659 TGTTGTGGGGTGGGGGGAAGGGG - Intronic
986934839 5:12870444-12870466 TGTTGTGGGGTGTGGGGAGGGGG - Intergenic
987032054 5:13985273-13985295 TGTTGTAGGGTGGGGGGAGGGGG + Intergenic
987165363 5:15192752-15192774 TGTTGTGGGGTGGGGGGAAGGGG - Intergenic
987203515 5:15601518-15601540 TGTAGGTGGGTGTGTGGGAAGGG + Intronic
987464790 5:18259325-18259347 TGTTGTGGGGTGGGGGGAAGGGG - Intergenic
987750283 5:22030108-22030130 GGTTGTGGGGTGGGGGGGAGGGG + Intronic
987880191 5:23734433-23734455 TGTGGTGGGGTGGGGGGAAGGGG - Intergenic
987914240 5:24190786-24190808 TGTTGTAGGGTGGGGGGAGGGGG - Intergenic
988064276 5:26214920-26214942 TGTTGTGGGGTGGGGGGAAGGGG + Intergenic
988083625 5:26444705-26444727 TGTTGTGGGGTGGGGGGGGGAGG + Intergenic
988086565 5:26481895-26481917 TGTTGTGGGGTGGGGGGGAGGGG + Intergenic
988126630 5:27047525-27047547 TGTAGTGGGGTGGGGGGAGGGGG + Intronic
988250722 5:28754813-28754835 TGTTGTGGGGTGTGGGGAGGGGG - Intergenic
988396494 5:30702423-30702445 TGTTGTGGGGTGGGGGGAAGGGG + Intergenic
988421866 5:31015556-31015578 AGTAGTGGGGGGTGGGGGGGCGG + Intergenic
988507330 5:31834729-31834751 TGTTGTGGGGTGGGGGGAAGGGG + Intronic
988667719 5:33348312-33348334 TGTTGTAGGGTGGGGGGAAGGGG - Intergenic
988836198 5:35035128-35035150 TGTAGCATGGAGTGGGAGAGAGG - Intronic
989189973 5:38661123-38661145 TGGAGCAGGGGGTGGGGGTGGGG + Intergenic
989254194 5:39349016-39349038 TGTTGTGGGGTGGGGGGGAGGGG + Intronic
989464797 5:41742628-41742650 TGTTGTGGGGTGGGGGGCAGGGG - Intronic
989599551 5:43188797-43188819 TGTAGTGGGGTGGGGGGAGGGGG + Intronic
989674597 5:43958762-43958784 TGTTGTGGGGTGGGGGGAAGGGG + Intergenic
989702433 5:44286256-44286278 TGTTGTGGGGTGGGGGGGAGAGG - Intergenic
989778594 5:45237998-45238020 TGTGATGGGGGGTGGGGGAGGGG - Intergenic
989850232 5:46199273-46199295 TGTTGTGGAGTGGGGGGGAGGGG + Intergenic
989969186 5:50500565-50500587 TGTTGTGGGGTGGGGGGAAGGGG + Intergenic
990089169 5:52019607-52019629 TGTTGTGGGATGGGGGGGAGGGG + Intronic
990107429 5:52281398-52281420 TGTTGTAGGGTGGGGGGAGGCGG + Intergenic
990363329 5:55043734-55043756 TGTGTTGGGGTGTGGGGGAGTGG - Intergenic
990710879 5:58578775-58578797 TGTTGTGGGGTGGGGGAGAGGGG + Intergenic
990733650 5:58836532-58836554 TTGAGAAGGGTGTGGGGGAAGGG - Intronic
990776120 5:59308206-59308228 TGTTGTGGGGTGGGGGGAAGGGG + Intronic
991157448 5:63455896-63455918 TGTTGTGGGGTGTGGGGAGGCGG + Intergenic
991168153 5:63587766-63587788 TGTTGTGGGGTGTGGGGTGGGGG + Intergenic
991357264 5:65781962-65781984 TGGGGGAGGGTGTGGGGGTGAGG - Intronic
991436054 5:66597452-66597474 AGGAGTAGGGTGGGGGGCAGCGG + Intronic
991546364 5:67785998-67786020 TGTTGTGGGGTGGGGGGAAGGGG + Intergenic
991557873 5:67915728-67915750 TGTAGTAGGGTGTGGAACAGTGG - Intergenic
991625788 5:68599756-68599778 TGTTGTGGGGTGGGGGGAAGGGG - Intergenic
992514811 5:77480669-77480691 TGTTGTAGGGTGCGGGGAGGGGG + Intronic
992660564 5:78956353-78956375 TGTAGGAAATTGTGGGGGAGAGG + Intronic
992753176 5:79879867-79879889 TGTTGTGGGGTGGGGGGAAGTGG - Intergenic
992849087 5:80785986-80786008 TGTTGTGGGGTGGGGGGAAGGGG + Intronic
993240625 5:85379996-85380018 TGTTGTGGGGTGGGGGGAAGAGG - Intergenic
993318082 5:86436506-86436528 TGTTGTGGGGTGGGGGGAAGGGG + Intergenic
993684664 5:90923776-90923798 TGTGGTGGGGTGGGGGGCAGGGG - Intronic
994142983 5:96361979-96362001 TGTCGTGGGGTGTGGGGAAGGGG - Intergenic
994258869 5:97633355-97633377 TGTGGTGGGGTGTGGGGAGGGGG + Intergenic
994259604 5:97641805-97641827 TGTTGTGGGGTGTGGGGAGGGGG - Intergenic
994261564 5:97665452-97665474 TGTTGTGGGGTGGGGGGAAGGGG - Intergenic
994288402 5:97997289-97997311 TGTTGTGGGGTGTGGGGGGTGGG + Intergenic
994369833 5:98955439-98955461 TGTTGTGGGGTGGGGGGGAGGGG - Intergenic
994414188 5:99447575-99447597 TGTTGTAGGGTGGGGGGAGGGGG - Intergenic
994439398 5:99783569-99783591 TCTACTAGGATGTGGGGGTGGGG - Intergenic
994449651 5:99926151-99926173 TGTTGTGGGGTGGGGGGGAGCGG + Intergenic
994526229 5:100908425-100908447 TGTTGTGGGGTGGGGGGGAGGGG - Intergenic
994575257 5:101569992-101570014 TGTTGTGGGGTGGGGGGAAGGGG - Intergenic
994616485 5:102110977-102110999 TGTGGTGGGGGGTGGGGGAAGGG - Intergenic
994682679 5:102908562-102908584 TGTTGTGGGGTGTGGGGAGGGGG + Intronic
994734832 5:103539733-103539755 TGTATAAGGGTGTGGGAGAGTGG - Intergenic
994972209 5:106755268-106755290 TCTTGTTGGGGGTGGGGGAGAGG + Intergenic
995304076 5:110622837-110622859 TGTTGTGGGGTGTGGGGAGGGGG + Intronic
995365507 5:111355648-111355670 TGTTGTGGGGTGTGGGGAGGGGG - Intronic
995411867 5:111866990-111867012 TGTTGTGGGGTGGGGGGAAGGGG + Intronic
995431899 5:112088740-112088762 TGTTGTGGGGTGGGGGGGAGGGG - Intergenic
995580723 5:113599231-113599253 TGTATTGGGGGGTGAGGGAGTGG - Intergenic
995586812 5:113656450-113656472 TGTAGTTGTGTGAGGGGCAGTGG - Intergenic
995684810 5:114760764-114760786 TGTTGTGGGGTGGGGGTGAGGGG - Intergenic
995703166 5:114958220-114958242 TGGAGTACTGGGTGGGGGAGAGG - Intergenic
995720278 5:115123240-115123262 TGTTGTGGGGTGTGGGGGAGGGG + Intergenic
995904911 5:117111938-117111960 TGTTGTGGGGTGGGGGGAAGGGG - Intergenic
996172381 5:120310272-120310294 TGTTGTGGGGTGTGGGGAGGGGG - Intergenic
996241440 5:121208111-121208133 TGCTGTCGGGTGGGGGGGAGGGG - Intergenic
996241818 5:121213660-121213682 TGTTGTGGGGTGGGGGGAAGGGG - Intergenic
996305792 5:122046192-122046214 TGTTGTGGGGTGAGGGGGGGTGG - Intronic
996792607 5:127308708-127308730 TGTTGTGGGGTGGGGGGAAGGGG + Intronic
996896405 5:128488647-128488669 TGTTGTGGGGTGGGGGGAAGGGG - Intronic
996902343 5:128556612-128556634 TGTTGTGGGGTGGGGGGAAGGGG + Intronic
996936611 5:128956855-128956877 TGTAGTGGGGTGTGGGTGGGGGG - Intronic
996958025 5:129209056-129209078 TGTGGTAGGGTGGGGGGAGGGGG - Intergenic
997045195 5:130307659-130307681 TGTTGTGGGGTGGGGGGAAGGGG - Intergenic
997078100 5:130704923-130704945 TGTTGTGGGGTGGGGGGAAGGGG + Intergenic
997082144 5:130752994-130753016 TGTTGTGGGGTGAGGGGAAGGGG - Intergenic
997112761 5:131093131-131093153 TGTTGTGGGGTGTGGGGAGGGGG + Intergenic
997246199 5:132351584-132351606 GGGAGTAGGGGGTGGGGGAGGGG - Intergenic
997630442 5:135364235-135364257 TGTGGGAGGGTGTGGGGCTGGGG + Intronic
997714139 5:136029408-136029430 TGTAGAAGGGAGTGGGGAAGTGG + Intronic
998247507 5:140520774-140520796 TGTTGTGGGGTGGGGGGGAGGGG + Intronic
998451214 5:142235819-142235841 TGGAGCAGGGAGTGGGGGTGGGG + Intergenic
998541413 5:142985652-142985674 TGTTGTAGGGTGGGGGGGAGGGG - Intronic
998573905 5:143292294-143292316 GGTGGTAAGGTGTTGGGGAGGGG + Intronic
998585667 5:143424057-143424079 TGTTGTGGGGTGTGGGGAGGGGG + Intronic
998926744 5:147135177-147135199 TGTAGTGGGGTGGGGGGATGGGG - Intergenic
999498273 5:152121817-152121839 TGTTGTAGGGTGGGGGGAGGGGG - Intergenic
999544929 5:152617085-152617107 TGTTGTGGGGTGGGGGGAAGGGG + Intergenic
999548117 5:152654106-152654128 TGTTGTGGGGTGGGGGGGAGGGG - Intergenic
999607417 5:153331169-153331191 TGTGGTGGGGTGGGGGGGGGAGG + Intergenic
999719276 5:154386594-154386616 TGTTGTGGGGTGGGGGGGTGTGG + Intronic
999810459 5:155122308-155122330 TGTTGTGGGGTGGGGGGAAGGGG - Intergenic
999860403 5:155639579-155639601 TGTCGTAGGGTGGGGGGAGGGGG - Intergenic
1000074278 5:157770460-157770482 TGTGGTGGCGGGTGGGGGAGCGG + Intergenic
1000424735 5:161077210-161077232 TGTCGTGGGGTGGGGGGCAGGGG + Intergenic
1000500369 5:162040957-162040979 GGTAGTAGGAGGTGGGGGAGAGG - Intergenic
1000708362 5:164539351-164539373 TGTTGTGGGGTGGGGGGCAGGGG + Intergenic
1000756465 5:165167340-165167362 TGTTGTGGGGTGGGGGGAAGGGG - Intergenic
1001167836 5:169386988-169387010 TGTCGTAGGGTGGGGGGGATGGG + Intergenic
1001399754 5:171439428-171439450 GGTGGGAGGTTGTGGGGGAGGGG + Intronic
1001538221 5:172514769-172514791 AGTGGTAAGGTGTGGGGGAGGGG - Intergenic
1001831751 5:174794874-174794896 GGGGGTGGGGTGTGGGGGAGAGG - Intergenic
1001857834 5:175028139-175028161 TGTTGTGGGGTTGGGGGGAGGGG - Intergenic
1002684298 5:180995785-180995807 TGGAGGTGGGAGTGGGGGAGTGG + Intronic
1202774620 5_GL000208v1_random:57589-57611 TGTTGTGGGGTGGGGGGAAGGGG - Intergenic
1002783449 6:384057-384079 TGGGGTCGGGAGTGGGGGAGTGG - Intergenic
1002800212 6:515229-515251 TGGGGTAGGGTGAGGTGGAGTGG - Intronic
1003276627 6:4659494-4659516 TGTAGTGGGGTGGGGGGAGGTGG - Intergenic
1003363405 6:5450347-5450369 GGTAACAGGGAGTGGGGGAGGGG + Intronic
1003593185 6:7452971-7452993 TGCAGTAGTGTCTGGGGGTGGGG - Intergenic
1003814002 6:9816609-9816631 TGTTGTGGGGTGTGGGGAGGGGG + Intronic
1003906837 6:10708677-10708699 TGTTGTGGGGTGGGGGGCAGGGG - Intronic
1004085953 6:12449486-12449508 TTTTGTAGGGGGTGGGGAAGGGG - Intergenic
1004302913 6:14474796-14474818 TGTCTGAGGGTGTGGGGGTGAGG + Intergenic
1004502989 6:16225713-16225735 TGTCGTGGGGTGGGGGGCAGGGG + Intergenic
1004556468 6:16703326-16703348 TGTTGTGGGGTGGGGGGAAGGGG + Intronic
1004591747 6:17058670-17058692 GGTAGTGGGGTGGGGGAGAGAGG + Intergenic
1004717710 6:18234182-18234204 TGTTGTGGGGTGGGGGGGACGGG + Intronic
1004782668 6:18928730-18928752 TGTTGTGGGGTGGGGGGAAGGGG - Intergenic
1004831255 6:19478638-19478660 TGTAGAAGGAGCTGGGGGAGTGG - Intergenic
1004933758 6:20487673-20487695 TTTAGTGGGGCTTGGGGGAGAGG - Intronic
1004937852 6:20525553-20525575 TGTAGTGGGGTGAGGGGAGGGGG + Intergenic
1004990870 6:21137019-21137041 TTTAGTAAGGGGTGGGGGCGAGG - Intronic
1005161554 6:22870288-22870310 TGTTGTTGGGTGTGGGGAGGGGG + Intergenic
1005177640 6:23064811-23064833 TGTTGTGGGGTGGGGGGGAGGGG + Intergenic
1005237351 6:23779880-23779902 TGTTGTGGGGTGGGGGGAAGGGG + Intergenic
1006240852 6:32677536-32677558 TGTTGTGGGGTGGGGGAGAGAGG - Intergenic
1006302316 6:33200168-33200190 CGGGGGAGGGTGTGGGGGAGGGG + Intronic
1006431468 6:34000023-34000045 TGAGAAAGGGTGTGGGGGAGAGG - Intergenic
1006578036 6:35060159-35060181 TGGAGCAGAGTGTCGGGGAGTGG + Exonic
1006633491 6:35446059-35446081 TGCAGCAGGTTGTGGGTGAGGGG + Intergenic
1006782833 6:36643716-36643738 TGAACGAGGGGGTGGGGGAGGGG - Intergenic
1006932471 6:37696496-37696518 TCTAGCAGGGTGTGGGAAAGTGG + Intronic
1006986448 6:38178734-38178756 AGCAGCAGGGTGTGGGGGGGAGG + Intronic
1007081508 6:39108411-39108433 GGTAGATGGGTGTGGGGGTGGGG + Intronic
1007137938 6:39540916-39540938 TGAAGTAGGGTAGAGGGGAGTGG - Intronic
1007347842 6:41246903-41246925 TGCTGTGGGGTGAGGGGGAGTGG + Intergenic
1007395088 6:41573232-41573254 TGGAGTGGGGGGTGGGAGAGGGG - Intronic
1007838338 6:44695264-44695286 TGTTGTGGGGTGGGGGGGAGAGG - Intergenic
1007979057 6:46131305-46131327 TGTTGTGGGGTGGGGGGAAGGGG - Intronic
1008065771 6:47046351-47046373 AGTAGTGGGCAGTGGGGGAGTGG - Intergenic
1008133488 6:47745269-47745291 TGTAGTGGGGTGGGGGGAGGAGG - Intergenic
1008238134 6:49074838-49074860 TGTTGTGGGGTGGGGGGAAGGGG - Intergenic
1008490073 6:52077408-52077430 TCTAGAAGGGATTGGGGGAGGGG - Intronic
1008503235 6:52204420-52204442 TGTTGTGGGGTGGGGGGGAGGGG - Intergenic
1008634815 6:53400196-53400218 TGTTGTGGGGTGGGGGGAAGGGG - Intergenic
1008755500 6:54790312-54790334 TGTAGTGGGGTGCGGGGAGGAGG + Intergenic
1008817496 6:55586540-55586562 TGTTGTAGGGTGGGGGGAGGAGG - Intergenic
1009175494 6:60455489-60455511 TGTTGTGGGGTGGGGGGAAGGGG - Intergenic
1009437648 6:63636194-63636216 TGTGGAAGGGGATGGGGGAGGGG - Intronic
1009465475 6:63963104-63963126 TGTTGTGGGGTGGGGGGAAGGGG + Intronic
1009499751 6:64395627-64395649 TGTTGTCGGGTTGGGGGGAGGGG + Intronic
1009510925 6:64548673-64548695 TGTTGTGGGGTGTGGGGAGGGGG + Intronic
1009517401 6:64637438-64637460 TGTTGTGGGGTGTGGGGAGGGGG + Intronic
1009522795 6:64705822-64705844 TGTTGTGGGGTGGGAGGGAGGGG + Intronic
1009614152 6:65983321-65983343 TGTTGTAGGGTGGGGGGAGGGGG + Intergenic
1009663921 6:66652000-66652022 TGTTGTGGGGTGGGGGGAAGGGG - Intergenic
1009677149 6:66840675-66840697 TGTTGTGGGGTGTGGGGAGGGGG - Intergenic
1009689987 6:67018275-67018297 TGTTGTGGGGTGGGGGGGTGGGG - Intergenic
1009778463 6:68236915-68236937 TGTTGTGGGGTGTGGGGAGGGGG + Intergenic
1009805559 6:68597866-68597888 TATTGTGGGGTGTGGGGGAGTGG + Intergenic
1009813533 6:68700816-68700838 TGTCGTAGGGTGGGGGGAGGGGG + Intronic
1009869772 6:69439687-69439709 TGTTGTGGGGTGGGTGGGAGGGG - Intergenic
1009900020 6:69798806-69798828 TGTTGTAGGGTGGGGGAAAGTGG - Intergenic
1009944166 6:70323553-70323575 TGTTGTGGGGTTGGGGGGAGAGG + Intergenic
1009979911 6:70715656-70715678 TGGAGTAGGGTAGGTGGGAGAGG + Intronic
1010093549 6:72012325-72012347 TGTTGTAGGGTGGGGGAAAGAGG + Intronic
1010125489 6:72427008-72427030 TGTTGTGGGGTCGGGGGGAGCGG - Intergenic
1010139114 6:72592940-72592962 TGTTGTAGGGTGTGGGGTGAGGG - Intergenic
1010441435 6:75899881-75899903 TGTTGTAGGGTGGGGGGAGGGGG - Intronic
1010492262 6:76490280-76490302 TGTAATTGGGAGTGGGGGGGGGG + Intergenic
1010582499 6:77616898-77616920 TGTTGTGGGGTGGGGGGTAGGGG + Intergenic
1010589277 6:77694408-77694430 TGTTGTGGGGTGGGGGGAAGGGG - Intronic
1010683641 6:78825580-78825602 TGTTGTAGGGTGGGGGGAGGGGG - Intergenic
1010758166 6:79691501-79691523 TGTTGTGGGGTGTGGGGAGGGGG - Intronic
1010851150 6:80779950-80779972 TGTTGTGGGGTGGGGGGGAGTGG - Intergenic
1010877298 6:81123394-81123416 TGTTGTGGGGTGGGGGGGAGGGG - Intergenic
1011087046 6:83552458-83552480 TGTTGTGGGGTGGGGGGGAGGGG + Intergenic
1011142809 6:84178806-84178828 TGTCGTGGGGTTGGGGGGAGCGG - Intronic
1011835359 6:91423921-91423943 TGTTGTGGGGTGGGGGGAAGGGG + Intergenic
1011876788 6:91971843-91971865 TGTTGTGGGGTGGGGGGAAGGGG - Intergenic
1011953899 6:93001147-93001169 TGTTGTGGGGTGGGGGGAAGGGG + Intergenic
1012214071 6:96560133-96560155 TGTTGTAGGGTGAGGGGCTGGGG + Intergenic
1012336031 6:98059594-98059616 TGTTGTGGGGTGTGGGGAGGGGG - Intergenic
1012369226 6:98482355-98482377 TGTTGTGGGGTGGGGGGAAGGGG + Intergenic
1012479775 6:99653682-99653704 TGTAGTAGGGTGGGGGGTGGGGG - Intergenic
1012494165 6:99815793-99815815 TGTCGTGGGGTGGGGGGGTGGGG + Intergenic
1012502164 6:99900295-99900317 TGTTGTGGGGTGGGGGGCAGGGG + Intergenic
1012728381 6:102846202-102846224 TGTCTTAGGGTGTGTGAGAGAGG + Intergenic
1012780909 6:103556718-103556740 TGTTGTGGGGTGGGGGGAAGGGG - Intergenic
1012807893 6:103918024-103918046 TGTTGTGGGGTGGGGGGGAGGGG + Intergenic
1012970316 6:105722112-105722134 TGTAGTGGGGTGGGGGGAGGGGG + Intergenic
1013326747 6:109053433-109053455 TAAAGCATGGTGTGGGGGAGGGG + Intronic
1013897989 6:115114893-115114915 TGTTGTGGGGTGTGGTGGTGGGG + Intergenic
1013971413 6:116024411-116024433 TGTTGTGGGGTGTGGGGAGGGGG - Intronic
1014068500 6:117154271-117154293 TGGGGTGGGGTGTTGGGGAGTGG - Intergenic
1014132603 6:117851830-117851852 TGTTGTGGGGTGGGGGGAAGGGG - Intergenic
1014221122 6:118799733-118799755 TGTTGTGGGGTGGGGGGAAGGGG + Intergenic
1014260841 6:119215044-119215066 TGTTGTGGGGTGGGGGGAAGGGG + Intronic
1014277800 6:119405942-119405964 TGTTGTGGGGTGGGGGGAAGGGG + Intergenic
1014345352 6:120263535-120263557 TGTTGTGGGGTGTGGGGAGGGGG - Intergenic
1014383401 6:120772573-120772595 TGTTGTGGGGTGGGGGGAAGGGG - Intergenic
1014681490 6:124436601-124436623 TGGAGTGGGCTGTGGGAGAGAGG - Intronic
1014935462 6:127380442-127380464 AGGGGTTGGGTGTGGGGGAGGGG - Intergenic
1014973447 6:127848065-127848087 TGTTGTGGGGTGGGGGGGAGGGG - Intronic
1015024364 6:128516179-128516201 AGTAGGAGGGAGTGTGGGAGGGG + Intronic
1015080519 6:129219822-129219844 TGTTGTGGGGTGGGGGGGAGGGG + Intronic
1015080692 6:129222488-129222510 TGTCGTAGGGTGGGGGGAGGGGG - Intronic
1015191960 6:130481502-130481524 GGTTGTAGGGTGGGGGGTAGGGG + Intergenic
1015787094 6:136929513-136929535 GGTGGTAAGGTTTGGGGGAGGGG + Intergenic
1015989806 6:138927159-138927181 TGGGGTAGGGAGTGGGGAAGCGG - Intronic
1016033786 6:139364151-139364173 TGTCGTGGGGTGGGGGGTAGGGG + Intergenic
1016146765 6:140687449-140687471 TGTTGTGGGGTGGGGGGAAGGGG - Intergenic
1016364590 6:143302370-143302392 TGTTGTGGGGTCGGGGGGAGTGG - Intronic
1016380070 6:143468803-143468825 TGTCGTGGGGTGGGGGGGGGGGG - Intronic
1016660022 6:146567390-146567412 TGTTGTGGGGTGTGGGGAGGGGG + Intergenic
1016665802 6:146638599-146638621 TGTTGTGGGGTGGGGGGGGGGGG + Intronic
1017017928 6:150116508-150116530 TGAGGTAGGGGGTGGGGGTGAGG - Intergenic
1017033451 6:150245119-150245141 GGGAGTAGGGTGTGGCGGGGAGG - Intronic
1017272096 6:152518982-152519004 TGTTGTAGGGTGGGGGGAGGGGG + Intronic
1017274522 6:152550555-152550577 TGTATGGGGGTGTGGGAGAGAGG + Intronic
1017516237 6:155158278-155158300 TGTAGTAAAGTGGGAGGGAGAGG - Intronic
1017597070 6:156039997-156040019 TGTGGTGGGGTGGGGGGAAGGGG + Intergenic
1017852524 6:158317312-158317334 TGTCGTGGGGTGGGGGGCAGGGG - Intronic
1017861475 6:158402224-158402246 GGGAGTAGGGTGTGGGGGCATGG - Intronic
1018102827 6:160456554-160456576 TGCAGAAGGGGGTGGGAGAGAGG + Intergenic
1018175250 6:161172789-161172811 TGTTGTGGGGTGGGGGGAAGGGG - Intronic
1018650926 6:165990550-165990572 TGTAGCAGTGTGTGGTGGGGTGG - Intergenic
1018682420 6:166275350-166275372 TGTTGTGGGATGTGGAGGAGGGG + Intergenic
1018875727 6:167821023-167821045 TGTACTGGGGTGCGGGGTAGGGG - Intergenic
1018990190 6:168668791-168668813 GGATGCAGGGTGTGGGGGAGGGG - Intronic
1018990220 6:168668874-168668896 GGATGTGGGGTGTGGGGGAGGGG - Intronic
1018990235 6:168668913-168668935 GGACGCAGGGTGTGGGGGAGGGG - Intronic
1018990289 6:168669053-168669075 GGACGCAGGGTGTGGGGGAGGGG - Intronic
1018990315 6:168669115-168669137 GGACGTAGGGTGTGGGGGAGGGG - Intronic
1018990367 6:168669222-168669244 GGGCGTGGGGTGTGGGGGAGGGG - Intronic
1019261017 7:82065-82087 TGTGGGAGGGTGTGTGGGTGTGG - Intergenic
1019498320 7:1351880-1351902 CTTAGTAGGGGGTGGGGGCGAGG + Intergenic
1019529225 7:1495291-1495313 CTTAGTGGGGTGTGGGGCAGGGG + Intronic
1019626781 7:2019818-2019840 TGTAGTTGGTTGTGGGGGCCAGG - Intronic
1019735672 7:2648743-2648765 TGCAGTAGGGTGGTGGGGGGGGG + Intronic
1020386104 7:7604059-7604081 TGTTGTGGGGTGCGGGGAAGGGG + Intronic
1020560226 7:9721971-9721993 TGGGGTAGGGAGTGGGGGAAGGG - Intergenic
1020705987 7:11544821-11544843 TGTAGTGGCGAGTGTGGGAGTGG - Intronic
1020851795 7:13363158-13363180 TGTGGTGGGGTGTGGGGGGAGGG + Intergenic
1021223988 7:18006870-18006892 TGTTGTGGGGTGGGGGGGGGGGG - Intergenic
1021244349 7:18243659-18243681 TGTAGGTGGCAGTGGGGGAGAGG - Intronic
1021334780 7:19385921-19385943 TGTTGTAGGGTGGGGGGAGGGGG + Intergenic
1021892848 7:25203709-25203731 GGTGGTAAGGTGTAGGGGAGGGG + Intergenic
1021925775 7:25532268-25532290 TGGAGTGGGGAGTGGGTGAGAGG - Intergenic
1021958010 7:25845741-25845763 TGCAGAAGGGCCTGGGGGAGAGG + Intergenic
1022094742 7:27131350-27131372 AGGAGCAGGGTGTGGGGAAGGGG - Intronic
1022157448 7:27674491-27674513 TGTAGGAGGGTGGGGGGCTGGGG + Intergenic
1022495850 7:30852612-30852634 TGTGGGAGGGGGTGGGGCAGGGG + Intronic
1022885030 7:34634170-34634192 TGTTGTGGGGTGTGGGGAGGTGG + Intergenic
1023127458 7:36969615-36969637 TGTAGTATGTGGTGGGGGTGTGG + Intronic
1023261680 7:38364177-38364199 TGTAGTGGGGTGGGGGGAGGGGG + Intergenic
1023362235 7:39428959-39428981 TGTCGTAGGGTGGGGGGAGGGGG + Intronic
1023691747 7:42796289-42796311 TGTTGTGGGGTGGGGGGAAGGGG + Intergenic
1024140005 7:46453378-46453400 TGTTGTGGGGTGTGGGGAGGGGG - Intergenic
1024380562 7:48690925-48690947 TGTTGTGGGATGGGGGGGAGGGG + Intergenic
1024414253 7:49083612-49083634 TGTAGGAGGGTGGGGGGCAAGGG + Intergenic
1024452206 7:49560243-49560265 TGTTGTGGGTTGGGGGGGAGGGG + Intergenic
1024457475 7:49626087-49626109 TGTAGTGGGGTGGGGGGATGGGG - Intergenic
1024477630 7:49830664-49830686 TGTCGTGGGGTGAGGGGGTGGGG - Intronic
1025154388 7:56590657-56590679 TGTGGTGGGGTGGGGGGAAGGGG + Intergenic
1025258345 7:57400114-57400136 TGTGGGAGGGTGTGGGGATGGGG + Intergenic
1025310210 7:57926792-57926814 TGTTGTAGAGTGGGGGTGAGGGG - Intergenic
1025616510 7:63122751-63122773 TGTTGTGGGGTGTGGGGGGGAGG + Intergenic
1025875886 7:65479285-65479307 TGTAGTGGGTTGTGTTGGAGGGG - Intergenic
1025886275 7:65597045-65597067 TGTTGTGGGGTGGGGGGGAGGGG - Intergenic
1026099614 7:67373818-67373840 TGTTGTGGGGTGGGGGGCAGGGG - Intergenic
1026385862 7:69847089-69847111 TGTACTGGGGGGTAGGGGAGAGG - Intronic
1027305080 7:76886032-76886054 TGTTGCAGGGTGTGGGGGCAAGG + Intergenic
1027318533 7:76998575-76998597 TGGAGTTGGGTGTGTGGGTGTGG + Intergenic
1027356757 7:77364517-77364539 TGTAGTGGGGTGGGGGGAGGGGG + Intronic
1027504836 7:79003191-79003213 TGTAGCAGGTGGTGGGGGGGAGG + Intronic
1027744426 7:82055758-82055780 TGTTGTAGGGTGGGGGGAGGGGG + Intronic
1027823975 7:83087063-83087085 TGTCATAGGGTGGGGGGAAGGGG + Intronic
1027967941 7:85038041-85038063 TGTTGTGGGGTGGGGGGGAGGGG + Intronic
1027976600 7:85164991-85165013 TGTTGTGGGGTGGGGGGAAGGGG - Intronic
1028063098 7:86346069-86346091 TGTTGTGGGGTGGGGGGGAGGGG + Intergenic
1028168740 7:87569691-87569713 TGTGGGGGGGTGTGGGGGACAGG + Intronic
1028283904 7:88970351-88970373 TGTAGAGGGTTGTGGGGGTGGGG - Intronic
1028423902 7:90664784-90664806 TGTTGTGGGGTGGGGGGAAGGGG + Intronic
1028471794 7:91213882-91213904 TGTTGTGGGGTGGGGGGGAGGGG - Intergenic
1028519784 7:91717160-91717182 TGTGGTGGGGTGTGGGGAGGGGG - Intronic
1028561765 7:92183900-92183922 TGTTGTGGGGTGGGGGGAAGGGG - Intergenic
1028746038 7:94327785-94327807 TGTCGTGGGGTGTGGGGAGGGGG + Intergenic
1028802440 7:94981970-94981992 TGTAGTGGGGTGGGGGGTTGGGG - Intronic
1028897270 7:96056041-96056063 TGTAGTTGGGTCTGGCAGAGAGG - Intronic
1028901804 7:96109359-96109381 TGTTGTGGGGTGTGGGGAGGGGG - Intronic
1029045982 7:97629226-97629248 TGTTGTGGGGTGGGGGGGAGGGG + Intergenic
1029507886 7:100973420-100973442 TGTAGTAGGGGCTGGGGCAATGG - Intronic
1029512835 7:101007386-101007408 GGTAGTAGGGTGGAGGTGAGAGG - Intronic
1029695831 7:102212655-102212677 TGGGGTGGGGTGTGGGGGTGGGG - Intronic
1029802388 7:102962827-102962849 TGTTGTGGGGTGGGGGGAAGGGG + Intronic
1029842562 7:103382005-103382027 TGTGGTATGGTGTTGGGGGGAGG - Intronic
1029880883 7:103808256-103808278 TGTTGTGGGGTGTGGGGAGGGGG + Intronic
1029909370 7:104128671-104128693 TGTTGTGGGGTGGGGGGGAGGGG - Intronic
1030183702 7:106737884-106737906 TGTTGTGGGGTGGGGGGAAGGGG + Intergenic
1030485696 7:110164262-110164284 TGTTGTGGGGTGGGGGGAAGGGG + Intergenic
1030519841 7:110584822-110584844 TGTTGTGGGGTGGGGGGAAGGGG + Intergenic
1030590155 7:111470719-111470741 TGTTGTGGGGTGGGGGGGAGGGG + Intronic
1030708124 7:112716415-112716437 TGTTGTAGGGTGTGGGGAGGGGG - Intergenic
1030709300 7:112731328-112731350 TGTCGTGGGGTGAGGGGAAGGGG - Intergenic
1030709763 7:112736460-112736482 TGTTGTTGGGTGTGGGGAGGGGG - Intergenic
1030775059 7:113524086-113524108 TGTTGTGGGGTGTGGGGAGGGGG + Intergenic
1030776498 7:113539516-113539538 TGTTGTGGGGTGGGGGGAAGGGG + Intergenic
1030853011 7:114514863-114514885 TGTTGTGGGGTGGGGGGAAGGGG - Intronic
1030947259 7:115738967-115738989 TGTTGTGGGGTGGGGGGGAGAGG + Intergenic
1031171903 7:118302767-118302789 TGTGGTGGGGTGTGGGGGAGGGG - Intergenic
1031179253 7:118393969-118393991 TGTTGTGGGGTGTGGGGAGGAGG + Intergenic
1031514112 7:122681124-122681146 TGTTGTAGGGTGGGGGGAGGGGG + Intronic
1031737588 7:125385700-125385722 TGTTGTGGGGTGGGGGGGAGCGG + Intergenic
1031760839 7:125711251-125711273 TGTCGTGTGGTGGGGGGGAGGGG + Intergenic
1031783087 7:125994770-125994792 TGTCGTGGGGTGGGGGGCAGTGG + Intergenic
1031866561 7:127043609-127043631 TGTTGTAGGGTGTGGGGAGCGGG + Intronic
1031905586 7:127456935-127456957 TGTCGTGGGGTGGGGGGCAGGGG + Intergenic
1032562322 7:132905093-132905115 TGTCGTGGGGTGGGGGGCAGGGG + Intronic
1032580547 7:133099500-133099522 TGAAGTAGGGTGAGGGGTGGAGG - Intergenic
1032643430 7:133794938-133794960 TGTTGTGGGGTGGGGGGAAGGGG - Intronic
1032774358 7:135095281-135095303 GGTGGTAAGGTATGGGGGAGAGG - Intronic
1033321385 7:140343001-140343023 TGCAGTAGAGTGTCTGGGAGAGG + Intronic
1033448523 7:141442217-141442239 TGTGGGAGGGTGTGTGAGAGGGG - Intronic
1033493731 7:141871857-141871879 TGTAGGAGGGTGGGGGGCTGGGG + Intergenic
1033633130 7:143181150-143181172 TGTTGTGGGGTGTGGGGAGGGGG + Intergenic
1033647106 7:143313954-143313976 TGGAGTAGGGGGTGGGAGAATGG - Intergenic
1033839244 7:145353835-145353857 TGTTGTGGGGTGGGGGGAAGGGG + Intergenic
1033989724 7:147268506-147268528 TGTTGCAGGGTGTGGGGTAGGGG + Intronic
1034248083 7:149664526-149664548 GGGAGTAGGGGTTGGGGGAGAGG - Intergenic
1034360484 7:150492490-150492512 TGTTGTAGGGTGGGGGGAAGGGG + Intergenic
1034360538 7:150493450-150493472 TGTTGTGGGGTCGGGGGGAGTGG - Intergenic
1034370293 7:150589180-150589202 TGTTGTGGGGTGGGGGGAAGGGG + Intergenic
1034855248 7:154539477-154539499 TGTTGTACGGTGGGGGGCAGGGG + Intronic
1034918374 7:155059438-155059460 TGTAGTAGGAACTGGGGCAGTGG - Intergenic
1034933668 7:155183965-155183987 TGTGTTATGTTGTGGGGGAGTGG + Intergenic
1034939227 7:155219566-155219588 TGTAGGAGTGTTTGGGGGAATGG - Intergenic
1035011290 7:155717522-155717544 TGGGGTTGGGTGTGGGGGCGGGG + Intronic
1035182570 7:157100002-157100024 TGTTGTGGGGTGTGGGGAGGGGG - Intergenic
1035406999 7:158605388-158605410 TGTTGTGGGGTGTGGGGAGGGGG + Intergenic
1035451175 7:158977882-158977904 GGTAGAAGGGGGTGGGGGATGGG - Intergenic
1035724048 8:1813771-1813793 TGGGGCAGGGGGTGGGGGAGTGG - Intergenic
1035767489 8:2118958-2118980 AGTAGCTGGGTGTGGGTGAGAGG + Intronic
1035895376 8:3393834-3393856 TGTTGTGGGGTGTGGGGAGGGGG + Intronic
1035900143 8:3450457-3450479 TGTTGTGGGGTGTGGGGAGGGGG - Intronic
1036021391 8:4851095-4851117 TGTTGTGGGGTGTGGGGAGGGGG - Intronic
1036127889 8:6080263-6080285 TGTAGTGGGAAGTTGGGGAGAGG - Intergenic
1036978602 8:13443199-13443221 TGTTGTGGGGTGGGGGGAAGGGG + Intronic
1037073793 8:14687340-14687362 TGTTGTGGGGTGTGGGGAGGGGG - Intronic
1037165600 8:15824603-15824625 TGTTGTGGGGTGGGGGGAAGGGG + Intergenic
1037288763 8:17328561-17328583 TGTTGGCGGGGGTGGGGGAGTGG + Intronic
1037820798 8:22133695-22133717 TGTAGGTGGGTGGGCGGGAGGGG - Intergenic
1037932042 8:22886959-22886981 AGTTGCAGGGTGTAGGGGAGGGG + Intronic
1038051468 8:23817831-23817853 TGTTGTAGGGTGGGGGGAGGGGG - Intergenic
1038141404 8:24849311-24849333 TGTCATGGGGTGGGGGGGAGGGG - Intergenic
1038404004 8:27308546-27308568 GGTAGGTGGTTGTGGGGGAGCGG - Intronic
1038615860 8:29094151-29094173 TGTGGTAGGGTGGGTGGGTGTGG - Intronic
1038691092 8:29764331-29764353 TGTTGTGGGGTGGGGGGGAGGGG + Intergenic
1038697973 8:29822992-29823014 GGTACTAGGGTCTGGGGGAGGGG + Intergenic
1038840124 8:31177081-31177103 CGCAGAAAGGTGTGGGGGAGGGG - Intergenic
1038928294 8:32165013-32165035 TGTGTTGGGGGGTGGGGGAGAGG - Intronic
1039207299 8:35171617-35171639 TGTGGTGGGGTGTGGGGAGGGGG - Intergenic
1039352232 8:36775420-36775442 TGTTGTGGGGTTGGGGGGAGTGG + Intergenic
1039425930 8:37485935-37485957 TGTTGTAGGGTGGGGGGAGGGGG + Intergenic
1039426706 8:37492464-37492486 GGTAATAGCGTTTGGGGGAGAGG - Intergenic
1039755227 8:40515728-40515750 TGTTGTAGGGTGGTGGGGAGTGG - Intergenic
1040367338 8:46731384-46731406 TGTTGTGGGGTGGGGGGAAGGGG + Intergenic
1040369048 8:46750005-46750027 TGTTGTAGGGTGGGGGGAGGGGG + Intergenic
1040442156 8:47454472-47454494 TGTGGTGGGGTGCGGGGGTGGGG + Intronic
1040478310 8:47800453-47800475 TGTTGTGGGGTGGGGGGAAGGGG + Intronic
1040640583 8:49329715-49329737 TTTAGCAGGGTGTGAGGCAGAGG + Intergenic
1040693963 8:49973358-49973380 TGTTGTGGGGTGGGGGGAAGGGG + Intronic
1040774816 8:51029272-51029294 TGTTGTGGGGTGGGGGGGATGGG - Intergenic
1040832249 8:51690316-51690338 TGTTGTAGGGTGTGGGGAAGGGG - Intronic
1040910409 8:52512458-52512480 TGTTGTGGGGTGGGGGGAAGGGG + Intergenic
1041110129 8:54476104-54476126 GGTTCTAGGGTCTGGGGGAGGGG - Intergenic
1041231532 8:55757658-55757680 TGGAGGAGTGTGTGGGGCAGGGG - Intronic
1041565041 8:59267541-59267563 TGTCGTGGGGTGGGGGGAAGGGG - Intergenic
1041626404 8:60033891-60033913 TGTCGTGGGGTGTGGGGGGCTGG - Intergenic
1042073435 8:64961547-64961569 TGTTGTGGGGTGTGGGGAGGGGG + Intergenic
1042116671 8:65439291-65439313 TGTTGTGGGGTGGGGGGAAGGGG + Intergenic
1042128874 8:65566625-65566647 TTTACTAGGGTGCAGGGGAGAGG - Intergenic
1042638067 8:70900805-70900827 TGTAGTGGGGTCGGGGGTAGGGG - Intergenic
1042759466 8:72255559-72255581 TTGTGTAGGGTGTGGGGTAGAGG + Intergenic
1042818960 8:72909401-72909423 TGGAGCATGGTGTGGAGGAGAGG + Intronic
1043036125 8:75202467-75202489 TGTCGTGGGGTGTGGGGCAAGGG - Intergenic
1043038661 8:75230960-75230982 TGTCGTAGGGTGGGGGGAGGGGG + Intergenic
1043129659 8:76445645-76445667 TGTCGTGGGGTGGGGGGAAGGGG - Intergenic
1043207779 8:77469037-77469059 TGTTGTAGGGTGGGGGGAGGAGG - Intergenic
1043617367 8:82143579-82143601 TGCCGTAGGGTGGGGGGAAGGGG - Intergenic
1043696833 8:83230633-83230655 TGTTGTGGGGTGTGGGGAGGGGG - Intergenic
1044041668 8:87377298-87377320 TGTTGTGGGGTGTGGGGAGGGGG - Intronic
1044173725 8:89089716-89089738 TGTTGTGGGGTGGGGGGAAGGGG + Intergenic
1044196260 8:89379906-89379928 TGTTGTCGGGTGGGGGGAAGGGG + Intergenic
1044270767 8:90240446-90240468 TGTTGTGGGGTGGGGGGGAGAGG + Intergenic
1044324250 8:90842029-90842051 TGTGGGAGGGTGAGGGTGAGAGG + Intronic
1044428763 8:92084285-92084307 TGGAGTAGGAGGTGGGGGTGGGG + Intronic
1044960156 8:97522856-97522878 TGTAGTGGGGTGGGGGGAGGGGG - Intergenic
1044967752 8:97589727-97589749 TGTTGTGGGGTGTGGGGAGGGGG - Intergenic
1045077240 8:98584244-98584266 TGTTGTGGGGTGGGGGGAAGGGG - Intronic
1045154997 8:99458063-99458085 TGTTGTGGGGTTGGGGGGAGGGG - Intronic
1045177846 8:99744815-99744837 TGTTGTGGGGTGGGGGGAAGGGG + Intronic
1045267118 8:100628585-100628607 TGTTGTGGGGTGGGGGGAAGGGG + Intronic
1045431142 8:102116103-102116125 TGTCGTAGGGTGGGGGGAGGCGG + Intronic
1045764195 8:105647523-105647545 TGTTGTGGGGTGGGGGGGGGCGG - Intronic
1045802671 8:106119277-106119299 TGTCGTGGGGTGGGGGGAAGGGG + Intergenic
1045867599 8:106885722-106885744 TGTCGTGAGGTGGGGGGGAGTGG + Intergenic
1045868171 8:106893128-106893150 TGTAGGAGGGTGGGGGGCAAGGG - Intergenic
1045974067 8:108111399-108111421 TGTTGTGGGGTGGGGGGGATGGG - Intergenic
1046023362 8:108692984-108693006 TGCAGTAGAGTGTGGCAGAGAGG + Intronic
1046140018 8:110079472-110079494 TGTTGTGGGGTGGGGGGAAGGGG - Intergenic
1046302852 8:112320636-112320658 TGTCGTGGGGTGGAGGGGAGGGG - Intronic
1046383233 8:113476807-113476829 TGTAGTGGGGTGGGGGGAGGGGG - Intergenic
1046386937 8:113518248-113518270 TGTTGTGGGGTGGGGGGGAGGGG - Intergenic
1046406497 8:113779649-113779671 TGTTGTGGGGTGGGGGGAAGGGG - Intergenic
1046520448 8:115318818-115318840 TGTAGTGGGGTGGGGGGAGGGGG - Intergenic
1046707487 8:117471360-117471382 TGGAGTGGGGTGGGGGAGAGGGG - Intergenic
1046736270 8:117779299-117779321 TGTTGTGGGGTGGGGGGAAGGGG + Intergenic
1047044859 8:121041104-121041126 TGTCGTAGGGTGGGGGGAGGGGG - Intergenic
1047328149 8:123859698-123859720 TGTTGTGGGGTGGGGGGAAGGGG - Intronic
1047399916 8:124537768-124537790 TGGAGTAGGGGTTTGGGGAGGGG - Intronic
1047712109 8:127562838-127562860 TGTTGTGGGGTGGGGTGGAGGGG - Intergenic
1047880150 8:129184077-129184099 TGTTGTAGGGTGGGGGGACGGGG + Intergenic
1048096195 8:131297747-131297769 TGTTGTGGGGTGGGGGGAAGGGG + Intergenic
1048108347 8:131438262-131438284 TGTTGTGGGGTGGGGGGAAGGGG - Intergenic
1048227581 8:132603588-132603610 TTTAGTGGGGGGTGGGGGTGTGG + Intronic
1048343270 8:133556799-133556821 TGAAATATGGTGTGGTGGAGGGG + Intronic
1048420620 8:134274888-134274910 TGTAGTAGAGAGTGGGATAGGGG + Intergenic
1048515730 8:135108967-135108989 GGTAGTAGGGGGCTGGGGAGGGG - Intergenic
1048567851 8:135622181-135622203 TGTGGTAGGCACTGGGGGAGGGG - Intronic
1048695798 8:137026387-137026409 TGTTGTGGGGTTGGGGGGAGGGG + Intergenic
1048714008 8:137246575-137246597 TGTTGTAGGGTGAGGGGATGGGG + Intergenic
1048837787 8:138537626-138537648 TGTTGTGGGGTGGGGGGGAGGGG + Intergenic
1048859009 8:138709632-138709654 TGTAGTAGGGTGGGGGGAGGGGG + Intronic
1048881677 8:138877108-138877130 TGTGGCTGGGGGTGGGGGAGGGG - Intronic
1048985244 8:139731484-139731506 TGTGGGAGGGAGTGAGGGAGAGG + Intronic
1049002308 8:139833830-139833852 TGAACTTGAGTGTGGGGGAGGGG + Intronic
1049174608 8:141184103-141184125 TGTGGCAGGGTCTGGGGAAGAGG - Intronic
1049490775 8:142900413-142900435 TGTAGTGGGGTGAGGGGAGGGGG + Intronic
1049688599 8:143949190-143949212 TTTGCCAGGGTGTGGGGGAGGGG - Intronic
1049716089 8:144093351-144093373 TGTTGTGGGGTGGGGGAGAGGGG - Intergenic
1050015593 9:1229733-1229755 TGTGGTGGGGTGGGGGGGATGGG + Intergenic
1050075535 9:1858813-1858835 TGTTGTGGGGTGTAGGGAAGGGG - Intergenic
1050221511 9:3396186-3396208 TGTTGTGGGGTGGAGGGGAGGGG - Intronic
1050792217 9:9487206-9487228 TGTTGTTGGGTGGGGGGAAGGGG - Intronic
1050973366 9:11906594-11906616 TGTTGTGGGGTGGGGGGAAGGGG - Intergenic
1051312304 9:15789747-15789769 TGTCGTAGGGTGGGGGGAGGGGG - Intronic
1051422445 9:16902304-16902326 TGTTGTGGGGTGGGGGGAAGAGG - Intergenic
1051692969 9:19735853-19735875 TGTTGTGGGGTGGGGGGAAGGGG + Intronic
1051787957 9:20766970-20766992 TGTGGTGGGGTGGGGGAGAGGGG - Intronic
1051819148 9:21144187-21144209 TGTTGTAGGGTGGGGGGAGGGGG + Intergenic
1051925759 9:22322928-22322950 TGTTGTGGGGTGGGGGGAAGGGG + Intergenic
1051977043 9:22963040-22963062 TGTTGTGGGGTGAGGGGAAGGGG + Intergenic
1052154807 9:25172574-25172596 TGTTGTAGGGTGGGGGGAGGGGG - Intergenic
1052168388 9:25362788-25362810 TGTGGTAAAGTGTAGGGGAGGGG + Intergenic
1052193796 9:25687926-25687948 TGTCGTGGGGTGTGGGGAGGGGG - Intergenic
1052222898 9:26048699-26048721 TGTTGTGGGGTGGTGGGGAGTGG + Intergenic
1052285389 9:26778876-26778898 TGTCGTGGGGTGGTGGGGAGCGG + Intergenic
1052312726 9:27085624-27085646 TGTGGTAGGGAGTGGAGGAAGGG + Intergenic
1052403817 9:28033883-28033905 TGGACTTGGGTGTGGGGGATGGG - Intronic
1052408495 9:28092541-28092563 TGTTGTGCGGTGGGGGGGAGGGG + Intronic
1052417839 9:28201224-28201246 TGTGGTGGGGTTGGGGGGAGGGG - Intronic
1052670881 9:31555459-31555481 TAAAGTAGTGTGTGGGGAAGAGG + Intergenic
1052716501 9:32124339-32124361 TGTTGTGGGGTGTGGGGAGGGGG + Intergenic
1052743540 9:32416698-32416720 TGTGGCAGGCTCTGGGGGAGGGG + Intronic
1053026159 9:34729981-34730003 TGTGGTAGGGTGGTAGGGAGAGG + Intergenic
1053037667 9:34839046-34839068 TGTGGTAGGGTGATAGGGAGAGG + Intergenic
1053047901 9:34935723-34935745 TGTATTTGTGTGTGGGGGGGGGG + Intergenic
1053428902 9:38028903-38028925 GGTGGTAGGGTGAGGGTGAGGGG + Intronic
1053718553 9:40921764-40921786 TGTTGTGGGGTGTGGGGAGGGGG + Intergenic
1055064011 9:72100444-72100466 TGTTGTGGGGTGGGGGGAAGGGG + Intergenic
1055105995 9:72513664-72513686 TGTTGTGGGGTGTGGGGAGGGGG + Intergenic
1055451729 9:76436953-76436975 TGTCGTGGGGTGTGGGGAGGGGG + Intronic
1055456689 9:76479003-76479025 TGTTGTGGGGTGGGGGGAAGGGG - Intronic
1055712318 9:79076617-79076639 TGTTGTGGGGTGGGGGGAAGGGG + Intergenic
1055845260 9:80554972-80554994 TGTTTTAGTGTGTGTGGGAGGGG + Intergenic
1055923728 9:81488899-81488921 TGTGGTAGGGGGTGGGGGTGGGG - Intergenic
1055947124 9:81701734-81701756 TGTTGTAGGGTGGGGGGAAGGGG - Intergenic
1056084750 9:83135342-83135364 TGTCGTGGGGTGGGGGGAAGAGG + Intergenic
1056193472 9:84206900-84206922 TGGAATAGGGTGAGGGGGGGCGG + Intergenic
1056352317 9:85762616-85762638 TGTTGTGGGGTGTGGGGAGGGGG + Intergenic
1056546845 9:87620555-87620577 AGGAGTAGGGGGAGGGGGAGGGG + Intronic
1056705660 9:88950513-88950535 TGAAGTAGTGAGTGGAGGAGGGG - Intergenic
1057117444 9:92539341-92539363 TGGGGTGGGGGGTGGGGGAGCGG - Intronic
1057161523 9:92892056-92892078 TGGAGGTGGGTGTGGGGGGGCGG - Intergenic
1057533841 9:95878652-95878674 TGTTGTGGGGTGGGGGGAAGGGG - Intronic
1057844724 9:98514644-98514666 TGTTGTAGGGTGGGGGGAGGGGG + Intronic
1058204864 9:102091653-102091675 TGTTGTAGGGTGGGGGGAGGGGG - Intergenic
1058491074 9:105500264-105500286 GGTAGTAAGGTGTGTGGGAGGGG + Intronic
1058512189 9:105731452-105731474 TGTCGTGGGGTGAGAGGGAGGGG - Intronic
1058554076 9:106147746-106147768 TGTTGTGGGGTGGGGGGAAGGGG - Intergenic
1058563623 9:106257460-106257482 TGTTGTAGGGTGGGGGAGTGGGG - Intergenic
1058956606 9:109954503-109954525 TGTAGTGGGGTGGGGGGAGGGGG + Intronic
1059149859 9:111939610-111939632 TTTAGTAGGGTGAGGGTGGGGGG - Intergenic
1059492830 9:114683322-114683344 TGTCGTGGGGTGGGGGGAAGAGG - Intergenic
1059518146 9:114914744-114914766 AGGAGAAGGGTGTGGGGGAAAGG + Intronic
1059558631 9:115308927-115308949 TGTTGTGGGGTGGGGGGAAGGGG - Intronic
1059597036 9:115732189-115732211 TGTAGTATGCTATGAGGGAGGGG + Intergenic
1059672992 9:116509154-116509176 TGTCGTGGGGTGAGGGGAAGGGG - Intronic
1059803239 9:117772146-117772168 TGTAGGAGGGTGGGGGGCTGGGG + Intergenic
1059935123 9:119302712-119302734 TGAAGTAGGGTTTAGAGGAGGGG - Intronic
1059960724 9:119561778-119561800 TGTTGCGGGGTGTGGGGAAGGGG + Intergenic
1060032202 9:120224733-120224755 TGTTGTGGGGTGGGGGGAAGGGG + Intergenic
1060057862 9:120431107-120431129 TGTTGTGGGGTGAGGGGAAGGGG + Intronic
1060333148 9:122694181-122694203 TGTTGTGGGGTGGGGGGAAGGGG + Intergenic
1060661655 9:125408368-125408390 GGGAGTAGGGGGTGGGGCAGGGG - Intergenic
1060676366 9:125518892-125518914 TGTAGTAACCTGTGGGGTAGAGG + Intronic
1060778595 9:126394943-126394965 TGTAGTAGGGGGCGGGGCTGTGG + Intronic
1060881447 9:127120995-127121017 AGCAGTAGGGTGTGGTTGAGTGG + Intronic
1061185881 9:129052919-129052941 TGTAGGAGTGTGTTGGTGAGGGG + Intronic
1061447825 9:130651249-130651271 TGTGGTGAGGTGTGGGAGAGAGG - Intergenic
1061749919 9:132770446-132770468 TGGGGTAGGGGGTGGGGCAGGGG + Intronic
1061896621 9:133651802-133651824 GGTGGCAGGGTGTGGGGGCGGGG - Intronic
1203383696 Un_KI270435v1:90922-90944 TGTAGTCCGGTGTGGGGAGGGGG + Intergenic
1203386103 Un_KI270438v1:57473-57495 TGGAGTAGGGTGGAGTGGAGTGG + Intergenic
1203386801 Un_KI270438v1:63432-63454 TGGAGTGGGGTGTAGAGGAGTGG + Intergenic
1203386885 Un_KI270438v1:64273-64295 TGAAGTAGAGTGTAGTGGAGCGG + Intergenic
1203387127 Un_KI270438v1:66137-66159 TGTAGTGGAGTGTAGTGGAGAGG + Intergenic
1203342861 Un_KI270442v1:10308-10330 TGGAGTAGGGTGGAGGGCAGTGG + Intergenic
1203343473 Un_KI270442v1:14730-14752 TGTAGTGGAGTGTAGTGGAGAGG + Intergenic
1203343587 Un_KI270442v1:15620-15642 TGAAGTAGAGTGTAGTGGAGTGG + Intergenic
1203395117 Un_KI270512v1:20319-20341 TGTAGTCGGGTGGGGGGAGGGGG + Intergenic
1203401014 Un_KI270519v1:97271-97293 TGTTGTGGGGTGGGGGGGAGGGG + Intergenic
1203401083 Un_KI270519v1:98163-98185 TGTTGTGGGGTGGGGGGGAAAGG + Intergenic
1203403142 Un_KI270519v1:135372-135394 TGTAGTCGGGTGGGGGGAGGGGG + Intergenic
1203683387 Un_KI270757v1:9205-9227 TGTAGTCCGGTGTGGGGAGGGGG + Intergenic
1185479400 X:434866-434888 TGTTGTGGGGTGGGGGGAAGGGG + Intergenic
1185497618 X:567279-567301 TGTTGTGGGGTGTGGGGATGGGG - Intergenic
1185581333 X:1213171-1213193 GGGAGGAGGGGGTGGGGGAGAGG - Intergenic
1185867940 X:3639473-3639495 AGGGGTAGGGGGTGGGGGAGTGG + Intronic
1185946657 X:4384485-4384507 TGTAGCAGAGTGCAGGGGAGGGG + Intergenic
1186281316 X:7995810-7995832 GCTACTAGGGTGTGGGGCAGGGG + Intergenic
1186422961 X:9440930-9440952 TGAAGCAGGGAATGGGGGAGGGG + Intergenic
1186515230 X:10161768-10161790 TCTAGCAAGGGGTGGGGGAGAGG + Intronic
1186523839 X:10229540-10229562 TGTAGTGGGGTGGGGGGACGGGG - Intronic
1186531810 X:10304480-10304502 TGTTGTGGGGTGGGGGGAAGGGG - Intergenic
1186575706 X:10763311-10763333 TGTTGTGGGGTGGGGGGAAGGGG - Intronic
1186782652 X:12928746-12928768 TGTTGTGGGGTGGGGGGAAGTGG + Intergenic
1186786353 X:12959556-12959578 TGCAGTAGGGTGTGGTGGAAGGG + Intergenic
1186796006 X:13046837-13046859 TGGAGTAGGGTGTTGGGGGTAGG - Intergenic
1187271224 X:17781522-17781544 TGTTGTGGGGTGGGGGGAAGGGG - Intergenic
1187452742 X:19413146-19413168 TGTGGTGAGGTGTGGGGGTGGGG - Intronic
1187569944 X:20490653-20490675 TGTTGTGGGGTGGGGGGAAGGGG - Intergenic
1187594927 X:20760369-20760391 TGTTGTGGGGTGCGGGGAAGGGG + Intergenic
1187784962 X:22873407-22873429 TGTTGCAGGGTGGGGGTGAGGGG + Intergenic
1188130278 X:26422389-26422411 TGTTGTGGGGTGGGGGGAAGGGG - Intergenic
1188192864 X:27193789-27193811 TGTCCCAGGGTGTGGGGGTGGGG - Intergenic
1188760159 X:34017797-34017819 TGTTGTGGGGTGGGGGGGAGGGG + Intergenic
1188862210 X:35271334-35271356 TGTTGTGGGGTTGGGGGGAGGGG + Intergenic
1189260929 X:39678376-39678398 TGCAGGACGGTGTGGAGGAGGGG - Intergenic
1189391119 X:40577699-40577721 TATGGAAAGGTGTGGGGGAGGGG - Intergenic
1189667157 X:43367849-43367871 GGTAGTAAGTTGTAGGGGAGGGG - Intergenic
1189739811 X:44106136-44106158 TTAAGTAGGGTGTGGGGGGCAGG + Intergenic
1189764283 X:44354220-44354242 TATTGTGGGGTTTGGGGGAGGGG + Intergenic
1189860610 X:45267366-45267388 AGTAGTGGGGTGGTGGGGAGAGG - Intergenic
1189934374 X:46052179-46052201 TGTTGTGGGGTGGGGGGAAGGGG - Intergenic
1190245718 X:48688960-48688982 AGCAGGAGGGAGTGGGGGAGGGG - Exonic
1190387104 X:49893035-49893057 TTGGGTAGGGTGTGGGGGAAGGG - Intergenic
1190392125 X:49942550-49942572 TGTCGTGGGGTAGGGGGGAGGGG - Intronic
1190393358 X:49954694-49954716 TGTAGGAAGGAGTGGGGTAGTGG + Intronic
1190454644 X:50615781-50615803 TGTGGTGGGGGGAGGGGGAGTGG + Intronic
1190544586 X:51512463-51512485 TGTTGTGGGGTGGGGGGAAGGGG - Intergenic
1190630900 X:52384848-52384870 TGTTGTTGGGTGGGGAGGAGGGG + Intergenic
1190641046 X:52482882-52482904 AGGGGAAGGGTGTGGGGGAGGGG - Intergenic
1190646626 X:52529983-52530005 AGGGGAAGGGTGTGGGGGAGGGG + Intergenic
1190654878 X:52602574-52602596 TGTTGTGGGGTGGGGGGAAGAGG + Intergenic
1190775302 X:53547788-53547810 TGCAGTAGGGGGTGTGGGCGTGG + Exonic
1190892209 X:54580144-54580166 TGTTGTAGGGTGGGGGGAGGGGG - Intergenic
1190904812 X:54716524-54716546 TGTTGTAGGGTGGGGGGAGGGGG - Intergenic
1190945167 X:55085594-55085616 TGTTGTGGGGTGTGGGGATGGGG + Intergenic
1190963238 X:55272767-55272789 TGTTGTGGGGTGGGGGGAAGGGG + Intronic
1190977533 X:55421018-55421040 TGTTGTGGGGTGGGGGGAAGGGG - Intergenic
1190978560 X:55432512-55432534 TGTTGTGGGGTGTGGGGAGGGGG + Intergenic
1191011617 X:55765565-55765587 TGTTGTGGGGTCGGGGGGAGGGG - Intergenic
1191067922 X:56369963-56369985 TGTTGTGGGGTGCGGGGGAGGGG - Intergenic
1191090671 X:56617129-56617151 TGTTGGAGGGTGGGGGTGAGGGG - Intergenic
1191110557 X:56800437-56800459 TGTGGGATGGTGTGGGGGTGGGG + Intergenic
1191166467 X:57397849-57397871 TGTTGTGGGGTGGGGGGAAGGGG - Intronic
1191203046 X:57805182-57805204 TGTTGTGGGGTGGGGGGAAGGGG - Intergenic
1191208686 X:57861554-57861576 TGTTGTGGGGTGGGGGGAAGGGG + Intergenic
1191269988 X:58453443-58453465 TGTTGTCGGATGGGGGGGAGGGG - Intergenic
1191597023 X:62956990-62957012 TGTGGTGGGGTGGGGGGGGGAGG - Intergenic
1191709251 X:64132024-64132046 TGTTGTAGGGTGTGGGAGGGGGG - Intergenic
1191813067 X:65210914-65210936 TGTGGTGGGGTCGGGGGGAGGGG + Intergenic
1191881886 X:65850844-65850866 TGTCGTAGGGTGGGGGGATGGGG - Intergenic
1191893371 X:65967512-65967534 TGTTGTGGGGTGGGGGAGAGGGG + Intergenic
1191946053 X:66536438-66536460 TGTTGTGGGGTGGGGGGAAGGGG + Intergenic
1191983241 X:66949093-66949115 TGTTGTGGGGTGGGGGGGGGTGG + Intergenic
1192002529 X:67169711-67169733 TGTGGTGGGGTCGGGGGGAGGGG + Intergenic
1192011008 X:67272402-67272424 TGTTGTGGGGTGGGGGGGAGGGG + Intergenic
1192160939 X:68786943-68786965 TGTCGTGGGGTGTGGGGAGGGGG + Intergenic
1192371296 X:70515266-70515288 TGTTGTGGGGTGGGGGGGGGTGG - Intergenic
1192481615 X:71491208-71491230 TGGAGCAGGCTGTGGGGAAGCGG + Intronic
1192712994 X:73611165-73611187 TGTTGTGGGGTGTGGGAGAGGGG - Intronic
1192718915 X:73671915-73671937 TGTTGTGGGGTGTGGGAGCGGGG - Intronic
1192760826 X:74094761-74094783 TGTTGTGGGGTGTGGGAGGGGGG - Intergenic
1192904625 X:75537946-75537968 TGTTGTGGGGTGGGGGGAAGGGG - Intergenic
1192904959 X:75541416-75541438 TGTTGTGGGGTGGGGGGAAGGGG + Intergenic
1192906295 X:75555304-75555326 TGTGGTGGGGTGGGGGGAAGGGG - Intergenic
1192946732 X:75971079-75971101 TGTTGTAGGGTGGGGGGAGGGGG + Intergenic
1192959499 X:76112515-76112537 TGTTGTGGGGTGGGGGGAAGGGG - Intergenic
1193198851 X:78664755-78664777 TGTGGTGGGGTGTGGTAGAGAGG + Intergenic
1193389325 X:80907426-80907448 TGTTGTGGGGTGGGGGGAAGGGG + Intergenic
1193392257 X:80942533-80942555 TGTTGTAGGGTGGGGGGATGGGG + Intergenic
1193465108 X:81838457-81838479 TGTTGTGGGGTGGGGGGAAGGGG + Intergenic
1193522323 X:82546679-82546701 TGTTGTGGGGTGGGGGGTAGGGG - Intergenic
1193588329 X:83355425-83355447 TTTAGTTGGGGGTGGGGGTGGGG + Intergenic
1193595756 X:83442909-83442931 TGTTGTGGGGTGAGGGGAAGGGG + Intergenic
1193606747 X:83578443-83578465 TGTAGTGGGGTGGGGGGAGGGGG + Intergenic
1193609794 X:83616802-83616824 GGTAGTAGGGTGTGAGGAAGTGG - Intergenic
1193675757 X:84449951-84449973 TGTTGTGGGGTGGGGGGAAGGGG + Intronic
1193682336 X:84538028-84538050 TGTGGTAGGGTGGCGGGAAGGGG + Intergenic
1193705759 X:84819135-84819157 TGTTCTGGGGTGGGGGGGAGGGG + Intergenic
1193739174 X:85197643-85197665 TGTTGTGGGGTGTGGGGAGGGGG - Intergenic
1193749329 X:85323440-85323462 TGTTGTGGGGTGGGGGGAAGGGG + Intronic
1193855098 X:86590967-86590989 TGTTGTAGGGTGCGGGGAAGGGG - Intronic
1193896657 X:87122171-87122193 TGTAGTGGGGTGTGGGGAGGGGG + Intergenic
1193966136 X:87988695-87988717 TGTTGTGGGGTGTGGGGAGGGGG + Intergenic
1194064744 X:89247768-89247790 TGTTGTAGGGTGGGGGGAGGGGG - Intergenic
1194182564 X:90731749-90731771 TGTTGTGGGGTGTGGGGCTGGGG + Intergenic
1194273450 X:91849893-91849915 TGTAGTAGGATGTAGTGGGGAGG - Intronic
1194342453 X:92721505-92721527 TGTTGTGGGGTGGGGGGCAGGGG + Intergenic
1194380973 X:93191239-93191261 TGTTGTAGGGTGGGGGGAGGGGG - Intergenic
1194385419 X:93246498-93246520 TGTTCTGGGGTGGGGGGGAGGGG - Intergenic
1194512504 X:94813346-94813368 TGTTGTGGGGTGGGGGGAAGGGG + Intergenic
1194622512 X:96190497-96190519 TGTTGTAGGGTGGGGGGAGGGGG + Intergenic
1194652291 X:96530401-96530423 TGTTGTAGGGTGGGGGGATGGGG + Intergenic
1194669147 X:96708533-96708555 TGTCGCAGGGGGTGGGGGACGGG - Intronic
1194727526 X:97415698-97415720 TGTTGTGGGGTGGGGGGCAGGGG + Intronic
1194998993 X:100623889-100623911 TGTTGTGGGGTGTGGGGAAGGGG - Intergenic
1195139002 X:101940035-101940057 TGTTGTGGGGTGTGGGGAGGGGG - Intergenic
1195154734 X:102111563-102111585 TGTTGTGGGGTGTGGGGAGGGGG - Intergenic
1195405293 X:104506120-104506142 TGTTGTGGGGTTGGGGGGAGGGG - Intergenic
1195409202 X:104550615-104550637 TGTTGTGGGGTGGGGGGGAGGGG + Intergenic
1195416969 X:104630984-104631006 TGTTGTGGGGTGTGGGAGGGGGG - Intronic
1195422592 X:104692497-104692519 TGTCGTGGGGTGGGGGGAAGGGG - Intronic
1195425907 X:104730368-104730390 TGTTCTGGGGTGGGGGGGAGGGG - Intronic
1195433001 X:104810259-104810281 TGTTGTGGGGTGAGGGGAAGGGG + Intronic
1195518366 X:105802759-105802781 TGTTGTGGGGTGTGGGGAGGGGG + Intergenic
1195652339 X:107298362-107298384 AGGAGCAGGGTGTGGGGGTGGGG + Intergenic
1195730969 X:107966950-107966972 GGTTGTGGGGTGGGGGGGAGGGG - Intergenic
1195887141 X:109650522-109650544 TGTTGTGGGGTGGGGGGAAGGGG + Intronic
1196002459 X:110800813-110800835 TGTTGTGGGGTGTGGGGAGGGGG + Intergenic
1196119442 X:112033214-112033236 TGTAGTGGGGTGGGGGGAGGGGG + Intronic
1196147284 X:112332003-112332025 TGTTGTGGGGTGGGGGGAAGGGG + Intergenic
1196283213 X:113848559-113848581 TGTTGTGGGGTGGGGGGAAGGGG - Intergenic
1196322024 X:114352318-114352340 TGTAGTGAGGTGTGAGTGAGAGG + Intergenic
1196337833 X:114559279-114559301 TGTTGTGGGGTGGGGGGGAGGGG + Intergenic
1196359002 X:114830843-114830865 TGTTGTGGGGTGGGGGGGAGGGG - Intronic
1196466715 X:115979284-115979306 TGTTGTGGGGTGGGGGGAAGGGG + Intergenic
1196621293 X:117827594-117827616 TGTTGTGGGGTGGGGGGGAGGGG - Intergenic
1196668197 X:118338405-118338427 TGTCGTGGGGTGAGGGGGAGGGG - Intergenic
1196835286 X:119808224-119808246 TGTTGTAGGCAGTGGGGGTGAGG - Intergenic
1196837146 X:119824002-119824024 TGTTGTAGGCAGTGGGGGTGAGG - Intergenic
1196866801 X:120077835-120077857 TGTAGTAGGGTGTGGGGGAGGGG + Intergenic
1196876298 X:120158446-120158468 TGTAGTAGGGTGTGGGGGAGGGG - Intergenic
1197006724 X:121511310-121511332 TGTCGTGGGGTGGCGGGGAGGGG - Intergenic
1197120631 X:122886846-122886868 TGTAGTGGGGTGGGGGGAGGGGG + Intergenic
1197485847 X:127050969-127050991 TGTTGTGGGGTGGGGGGAAGCGG - Intergenic
1197624666 X:128788506-128788528 TGTTGTGGGGTGTGGGGAGGGGG + Intergenic
1197679135 X:129363618-129363640 TGTAGCAGGCTGTAGGGGTGTGG + Intergenic
1197727493 X:129786086-129786108 CATAGGTGGGTGTGGGGGAGGGG - Intronic
1197920246 X:131584568-131584590 TGGGGTGGGGTGGGGGGGAGGGG + Intergenic
1198166983 X:134067483-134067505 TGTTGTGGGGTGGGGGGAAGAGG + Intergenic
1198342087 X:135724632-135724654 TGTTGTGGGGTGTGGGGAGGGGG - Intergenic
1198345903 X:135758663-135758685 TGTTGTGGGGTGTGGGGAGGGGG + Intergenic
1198347817 X:135776167-135776189 TGTTGTGGGGTGTGGGGAGGGGG + Intergenic
1198349722 X:135793429-135793451 TGTTGTGGGGTGTGGGGAGGGGG + Intergenic
1198351625 X:135810704-135810726 TGTTGTGGGGTGTGGGGAGGGGG + Intergenic
1198353536 X:135827967-135827989 TGTTGTGGGGTGTGGGGAGGGGG + Intergenic
1198355441 X:135845222-135845244 TGTTGTGGGGTGTGGGGAGGGGG + Intergenic
1198357351 X:135862507-135862529 TGTTGTGGGGTGTGGGGAGGGGG + Intergenic
1198359265 X:135879787-135879809 TGTTGTGGGGTGTGGGGAGGGGG + Intergenic
1198397676 X:136237871-136237893 TGTTGTGGGGTGTGGGGAGGGGG - Intronic
1198652098 X:138873998-138874020 TGTTGTGGGGTGGGGGGGAGGGG + Intronic
1198709940 X:139490654-139490676 TGTTGTGGGGTGTGGGGAGGGGG + Intergenic
1198980085 X:142385738-142385760 TGTTGTGGGGTGGGGGGGAGGGG - Intergenic
1198997145 X:142586037-142586059 TGTTGTGGGGTGGGGGGAAGGGG + Intergenic
1199739681 X:150722998-150723020 TGTTGTGGGGTGGGGGGAAGGGG - Intronic
1199837896 X:151611964-151611986 TGTTGTAGGGTGGGGGGAGGGGG - Intronic
1199889143 X:152057762-152057784 TGTTGTGGGGTGGGGGGAAGGGG - Intergenic
1199894476 X:152117578-152117600 TGGGGTAGGGTGTGGGGATGGGG + Intergenic
1199911269 X:152289662-152289684 TGTCGTGGGGTGGGGGGCAGGGG - Intronic
1199918753 X:152373773-152373795 TGTTGTAGGGTGGGGGGATGGGG - Intronic
1199929352 X:152502942-152502964 TGTCGTGGGGTGGGGGGAAGGGG + Intergenic
1199995064 X:153018579-153018601 TGTCGTGGGGTGGGGGGAAGGGG + Intergenic
1200301046 X:154976570-154976592 TGTTGTGGGGTGGGGGGAAGGGG - Intronic
1200352426 X:155512314-155512336 TGTTGTGGGGTGGGGGGAAGGGG - Intronic
1200529187 Y:4313707-4313729 TGTTGTGGGGTGTGGGGCTGGGG + Intergenic
1200569923 Y:4815594-4815616 TGTAGTGGGGTGTAGGGAGGGGG + Intergenic
1200590695 Y:5071309-5071331 TGTAGTAGGATGTAGTGGGGAGG - Intronic
1200693792 Y:6336851-6336873 TGTTGTGGGGTGTGGGGAGGGGG + Intergenic
1200819715 Y:7570200-7570222 TGTTGTGGGGTCGGGGGGAGTGG - Intergenic
1201041485 Y:9837874-9837896 TGTTGTGGGGTGTGGGGAGGGGG - Intergenic
1201108359 Y:10780482-10780504 TGGAGTGGAGTGTGGTGGAGTGG - Intergenic
1201131775 Y:10957966-10957988 TGTAGTAGAGTGGAGGGGAGAGG - Intergenic
1201132838 Y:10967857-10967879 TGAAGTGGAGTGCGGGGGAGTGG - Intergenic
1201133116 Y:10969788-10969810 TGGAGTAGAGTGTAGTGGAGTGG - Intergenic
1201134047 Y:10977007-10977029 TGTAGTTGAGTGGGGTGGAGTGG - Intergenic
1201139298 Y:11015069-11015091 TGTAGTAGAGTGGAGTGGAGTGG - Intergenic
1201141402 Y:11031655-11031677 TGTAGTGGAGTGGAGGGGAGTGG - Intergenic
1201246332 Y:12007533-12007555 TGTAGTGGGGTGGGGGGAGGGGG - Intergenic
1201249800 Y:12045355-12045377 TGTTGTGGGGTGGGGGGGAGGGG + Intergenic
1201250007 Y:12047569-12047591 TGTTGTAGGGTGTGGGGAGCAGG + Intergenic
1201256268 Y:12111281-12111303 TGTTGTGGGGTGGGGGGAAGGGG + Intergenic
1201387883 Y:13463012-13463034 TGTTGTGGGGTTGGGGGGAGGGG - Intronic
1201491313 Y:14544926-14544948 TGTTGTGGGGTGGGGGGAAGGGG - Intronic
1201699094 Y:16860137-16860159 TGTTGTGGGGTGGGGGGCAGGGG + Intergenic
1201704257 Y:16918037-16918059 TGTTGTGGGGTGGGGGGAAGGGG + Intergenic
1201761275 Y:17541390-17541412 TGTGGTGGGGTGGGGGGGTGGGG + Intergenic
1201768156 Y:17592341-17592363 TGTGGTGGGGTGGGGGGGGGGGG + Intergenic
1201833397 Y:18313644-18313666 TGTGGTGGGGTGGGGGGGGGGGG - Intergenic
1201840277 Y:18364600-18364622 TGTGGTGGGGTGGGGGGGTGGGG - Intergenic
1201887358 Y:18899762-18899784 TGTTGTGGGGTGTGGGGAGGGGG + Intergenic
1202024575 Y:20507072-20507094 TGTTGTGGGGTGGGGGGAAGAGG + Intergenic
1202104663 Y:21350616-21350638 TGTTGTAGTGTGTGGGGATGGGG - Intergenic
1202186866 Y:22194703-22194725 TGTTGTGGGGTGGGGGGAAGGGG + Intergenic
1202204494 Y:22391693-22391715 TGTTGTGGGGTGGGGGGAAGGGG - Intronic