ID: 1196876300

View in Genome Browser
Species Human (GRCh38)
Location X:120158448-120158470
Sequence GGTGTAGTAGGGTGTGGGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 739
Summary {0: 2, 1: 0, 2: 5, 3: 52, 4: 680}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196876300_1196876320 26 Left 1196876300 X:120158448-120158470 CCTCCCCCACACCCTACTACACC 0: 2
1: 0
2: 5
3: 52
4: 680
Right 1196876320 X:120158497-120158519 AACGCGTGCTCTCCCTCATCCGG 0: 2
1: 0
2: 0
3: 0
4: 47
1196876300_1196876321 27 Left 1196876300 X:120158448-120158470 CCTCCCCCACACCCTACTACACC 0: 2
1: 0
2: 5
3: 52
4: 680
Right 1196876321 X:120158498-120158520 ACGCGTGCTCTCCCTCATCCGGG 0: 2
1: 0
2: 0
3: 4
4: 84

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196876300 Original CRISPR GGTGTAGTAGGGTGTGGGGG AGG (reversed) Intergenic
900083489 1:875919-875941 AGTGTGGGAGAGTGTGGGGGAGG - Intergenic
900083508 1:875972-875994 AGTGTGGGAGAGTGTGGGGGAGG - Intergenic
900147937 1:1166535-1166557 GGTGCAGGCGGGGGTGGGGGTGG - Intergenic
900643565 1:3698592-3698614 CGTGGAGAAGGGTCTGGGGGAGG + Intronic
901317738 1:8320236-8320258 GCTGCAGTGGGGTGTGGCGGAGG + Intronic
901594107 1:10371196-10371218 GGTGGAGGAGGGAGTGAGGGTGG - Exonic
901632262 1:10653648-10653670 GGGGAAGTAGGGCGTGGGGGTGG + Exonic
902145194 1:14392737-14392759 GGCGGAGGCGGGTGTGGGGGTGG + Intergenic
902208304 1:14886015-14886037 GGTGTTGTGGGGTGGGGCGGGGG - Intronic
902455478 1:16530798-16530820 GGGGTGGCAGGGGGTGGGGGTGG + Intergenic
902496694 1:16877090-16877112 GGGGTGGCAGGGGGTGGGGGTGG - Intronic
902513026 1:16976428-16976450 GGTGGAGTAGGGGGTGGTGCTGG - Intronic
902661573 1:17907758-17907780 GGTGTAGTGGGGTGGAGGTGGGG + Intergenic
903242463 1:21992591-21992613 GGTGTGTTAGGGTCTGGTGGTGG + Intronic
903313966 1:22486193-22486215 GTGGTAGTAGGGTGCAGGGGAGG + Intronic
903483403 1:23670946-23670968 GGTGTAGGAGAGTGTGAGGCTGG + Intergenic
903561795 1:24233597-24233619 GGTGAAGTGGGGTCGGGGGGTGG - Intergenic
903641983 1:24866550-24866572 GCTGTAGCAGGCTGTGGGGATGG + Intergenic
903773141 1:25776763-25776785 GGTGAGGTAGGGTGTGAGGAGGG + Intronic
904375979 1:30082825-30082847 GGTGTGGTGGGGTGGGGTGGGGG - Intergenic
904385443 1:30138931-30138953 GCTGGGGTAGGGTGTGGGGTGGG + Intergenic
904695223 1:32326783-32326805 GCTGAAGTAGGGTGGGAGGGAGG + Intronic
905031436 1:34886515-34886537 GGTGGAGGTGGGGGTGGGGGTGG - Intronic
905091637 1:35435134-35435156 GCTGGGGTAAGGTGTGGGGGTGG - Intronic
905340157 1:37272617-37272639 GCTTTGGTAGAGTGTGGGGGCGG + Intergenic
905868758 1:41391208-41391230 GCAGTAGTTGGGTTTGGGGGAGG - Intergenic
905870529 1:41401663-41401685 GGGGTGGTGGGGTGTGGGGTGGG - Intergenic
906178797 1:43800175-43800197 GGTGTATGTTGGTGTGGGGGAGG - Intronic
906273744 1:44501033-44501055 GCTGCAGAAGGCTGTGGGGGTGG + Intronic
906685200 1:47758705-47758727 GGTGTGGTGGGGAGTGGGGCAGG + Intergenic
906715437 1:47965209-47965231 GGTGGAGGGGGGGGTGGGGGGGG + Intronic
907203922 1:52752352-52752374 GGTGGGGTAGGGTGTGCTGGAGG - Intronic
907311919 1:53543734-53543756 GTTCTGGAAGGGTGTGGGGGAGG + Intronic
907331769 1:53676400-53676422 GCTGTGCCAGGGTGTGGGGGAGG - Intronic
907332139 1:53678314-53678336 AGTGCAGGAGGGTGAGGGGGGGG + Intronic
907395271 1:54185370-54185392 GGTGTAGTATGGTCAGGGGTAGG + Intronic
907640828 1:56188615-56188637 GGTGAAGTAGGGAGTGGGTGGGG + Intergenic
908472639 1:64459103-64459125 GCTGGAGGAGGGTGTGGGGAGGG + Intergenic
908534883 1:65067588-65067610 GGCGCAGGTGGGTGTGGGGGCGG - Intergenic
909048983 1:70745659-70745681 TGTGTTGTAGGGTGTGGCTGTGG + Intergenic
909893597 1:81037695-81037717 GGAGTATGAGGGTGTGGTGGGGG - Intergenic
910305706 1:85760732-85760754 GGAGGAGTGGGGTGTGGGTGAGG + Intronic
912742233 1:112211011-112211033 GGTGAGGTAGGGAGTGGGGATGG + Intergenic
912889585 1:113514618-113514640 ACTGTTGTGGGGTGTGGGGGAGG + Intronic
913084199 1:115420374-115420396 GGTGAAGGAGTGGGTGGGGGTGG - Intergenic
913197762 1:116472124-116472146 GGGGAAGTAGGGTGTGGTAGAGG - Intergenic
913327509 1:117639581-117639603 GGTGTAGAATGCTATGGGGGTGG - Intergenic
913557930 1:119987533-119987555 GGTGGGGAAGGGAGTGGGGGAGG + Intronic
914276588 1:146130050-146130072 CCTGTTGTAGGGTGTGGGGAGGG - Intronic
914537633 1:148581005-148581027 CCTGTTGTAGGGTGTGGGGAGGG - Intronic
914586548 1:149067458-149067480 CCTGTTGTAGGGTGTGGGGAGGG - Intronic
915108352 1:153547941-153547963 GGTGTAGTTTGGGGTGGGGTGGG - Intronic
916085988 1:161269857-161269879 GGTGTAGTGGTGTGTGGCTGTGG + Intronic
916714237 1:167435822-167435844 GGACTAGGAGGGTGTGGGGAGGG - Intronic
918239859 1:182611662-182611684 GGGAGAGTAGGGGGTGGGGGTGG + Intergenic
918672655 1:187239148-187239170 GGTGGGGGAGGGTGTGGTGGGGG + Intergenic
918750917 1:188268330-188268352 GGTGGGGTATGGTATGGGGGTGG + Intergenic
919171476 1:193959573-193959595 CCTGTTGTAGGGTGAGGGGGCGG + Intergenic
919977902 1:202624694-202624716 CGTGTAGTAGGGTGTGTGTGTGG + Intronic
919977943 1:202625063-202625085 TGTGTAGTAGGGTGTGTGTGTGG + Intronic
919977972 1:202625394-202625416 TGTGTAGTAGGGTGTGTGTGTGG + Intronic
920053631 1:203177866-203177888 CGTGGAGTGGGGTGTGGGGAGGG - Intergenic
920214324 1:204351186-204351208 GGGGGAGTGGGGTGTGGCGGGGG + Intronic
921030745 1:211333435-211333457 GGCCTAGTGGGGAGTGGGGGGGG - Intronic
921302695 1:213765700-213765722 GGAGTAGTAGGGAGAGGGGCTGG - Intergenic
922307188 1:224354330-224354352 GCTCTAGTAGGGTGAGTGGGAGG - Intergenic
922597263 1:226823684-226823706 CTTGGAGTAGGGTGTGGGAGAGG - Intergenic
923448220 1:234092396-234092418 AGTGTAGGAGGGGGTGGGAGAGG - Intronic
924603582 1:245513136-245513158 GGTGGAGGAGGGTGTGGAGGAGG - Intronic
924676993 1:246189207-246189229 TGTGTAGTGGGGTGGGAGGGAGG - Intronic
1062919219 10:1266497-1266519 GCTGTGGTGGGGGGTGGGGGGGG + Intronic
1062981606 10:1727362-1727384 CGTGGAGTAGGGTTTGGAGGTGG - Intronic
1063282440 10:4645142-4645164 GGAGGAGTAGGCTGTGGGTGTGG - Intergenic
1063660915 10:8034728-8034750 GGGGCGGGAGGGTGTGGGGGAGG - Intergenic
1065069982 10:22013696-22013718 AGGGTAGTGGGGTGTTGGGGTGG - Intergenic
1065589701 10:27252044-27252066 GGTGGGGTAGGGTGGGGTGGGGG + Intergenic
1067295990 10:44975441-44975463 GGTGGAGAGGGGAGTGGGGGTGG - Intronic
1067813921 10:49456575-49456597 GGTGCAAGATGGTGTGGGGGTGG + Exonic
1068673034 10:59743202-59743224 GGTGTGGTGGGGGGCGGGGGCGG - Intergenic
1069152244 10:64978477-64978499 GTTGTAGTAGGGGGTAGGGGTGG + Intergenic
1069344023 10:67446270-67446292 GGTGGACTAGGGAGTAGGGGTGG - Intronic
1069507151 10:69010729-69010751 TGGGTAGTAGGATTTGGGGGGGG + Intronic
1069987302 10:72293187-72293209 GGGCTTGCAGGGTGTGGGGGAGG - Intergenic
1070444185 10:76478890-76478912 CCTGTTGTGGGGTGTGGGGGAGG + Intronic
1070481233 10:76884658-76884680 GGTGTTCTTGGGTGTGGGGTTGG - Intronic
1070676185 10:78413182-78413204 GGTGTTGTAGTGTGGGGGGAAGG + Intergenic
1070794368 10:79208120-79208142 GGTGGAGGTGGGGGTGGGGGGGG + Intronic
1071864172 10:89707653-89707675 GGTGTAATTGGGTGTGAAGGGGG - Intronic
1071880152 10:89888624-89888646 GGGGTAGGGGGGGGTGGGGGGGG - Intergenic
1072808575 10:98442903-98442925 GGACTGGTGGGGTGTGGGGGTGG + Intronic
1073672569 10:105608575-105608597 TGTGTGGCAGGGTGTGGAGGAGG - Intergenic
1073711255 10:106045323-106045345 GGTGGGGTGGGGGGTGGGGGTGG + Intergenic
1073974788 10:109087748-109087770 GGTGCAGTGTGGGGTGGGGGCGG - Intergenic
1074659540 10:115637317-115637339 GGTGTAATAAGATGTGGAGGTGG + Intronic
1075157531 10:119990268-119990290 GGTGGGGGAGGGCGTGGGGGAGG + Intergenic
1076359450 10:129876892-129876914 GGGGTAGCTGGGTGGGGGGGGGG - Intronic
1076653562 10:132006301-132006323 GGTGGGGGTGGGTGTGGGGGTGG + Intergenic
1076653572 10:132006317-132006339 GGGGTGGGAGGGGGTGGGGGTGG + Intergenic
1076676467 10:132149781-132149803 GGTGAGGTAGGGTGGGGTGGGGG - Intronic
1077177636 11:1197891-1197913 GGTGTTGCAGGCTGCGGGGGCGG - Intronic
1077218503 11:1404996-1405018 GGTGGTCTAGGGGGTGGGGGTGG + Intronic
1077351591 11:2095529-2095551 GGTGTAAGAGCGTGTTGGGGTGG - Intergenic
1077440437 11:2566349-2566371 GGTGTCCTCGGGTGTGGGAGAGG - Intronic
1077898667 11:6473368-6473390 GGTGGGGTAGGGTGGGGGTGGGG + Intronic
1078059163 11:8032259-8032281 GTGGTAGTTGGGGGTGGGGGCGG - Intronic
1078062750 11:8059064-8059086 GGTGAGGTAGGGTGGGGTGGAGG + Intronic
1078740809 11:14064649-14064671 GGTGTGGTAGAGGTTGGGGGTGG + Intronic
1079028723 11:16969069-16969091 GGGGTTTTAGGGTGTGTGGGAGG + Intronic
1079213261 11:18483039-18483061 TGTGTAGCAGGGGGTGGGGAGGG + Intronic
1081455195 11:43214681-43214703 GGTGTCGGGGGGTGGGGGGGTGG - Intergenic
1081599497 11:44483555-44483577 GTTGTAGTGGGAGGTGGGGGTGG - Intergenic
1081605964 11:44527156-44527178 GGTGAAGGAAGGTGTGGGGCTGG + Intergenic
1082059381 11:47847628-47847650 GGTGTATGTGTGTGTGGGGGTGG + Intronic
1082267005 11:50129953-50129975 GGGGTGGTGGGGTTTGGGGGTGG + Intergenic
1082289084 11:50348615-50348637 GGGGTGGTGGGGTTTGGGGGTGG - Intergenic
1082991825 11:59213191-59213213 GAAGCAGTAGGGTGTGGGGTCGG - Intergenic
1083387115 11:62319542-62319564 AGGGTAGTAGGGGGTGGTGGTGG - Intergenic
1083421338 11:62554904-62554926 GGTGGAGTAGGGTATGGTGGGGG - Intronic
1083550942 11:63589888-63589910 AGTGTAGTCGGGGGCGGGGGTGG - Intronic
1084185118 11:67467436-67467458 GGTGCAGGAGGCTGTGGGGGTGG + Intronic
1084213349 11:67633985-67634007 GGTGGAAAAGGGGGTGGGGGCGG - Intronic
1084282500 11:68107598-68107620 GCTGTAGTGGGGGTTGGGGGAGG - Intronic
1084358515 11:68654535-68654557 GGTGTAGTGGGAAGTGGGGAGGG - Intergenic
1084403058 11:68956092-68956114 GGTGGGGTAGGGTGGGGGGCTGG + Intergenic
1084425742 11:69083776-69083798 TGTGTAGAGGCGTGTGGGGGTGG + Intronic
1084496181 11:69504991-69505013 GATGAAGTGGGGAGTGGGGGTGG + Intergenic
1084713692 11:70860183-70860205 GGTGTGATAGGGTATGGAGGTGG - Intronic
1085275152 11:75293697-75293719 GGTGGGGTTGGGTGTGGTGGGGG - Intronic
1086072907 11:82819134-82819156 GATGTGGTGGGGTGTGGGGTTGG - Intergenic
1086242391 11:84711399-84711421 GGTGGGGGAGGGGGTGGGGGAGG - Intronic
1086394155 11:86397032-86397054 GTTGGAGTAGGGAGTGGGGGTGG - Intronic
1087154757 11:94890116-94890138 GGGGTCGGAGGGTGAGGGGGTGG - Intergenic
1088863287 11:113821894-113821916 GGTGGTGGAGGGTGTGAGGGTGG + Intronic
1088928399 11:114325077-114325099 GGGGTGGGAGGGTGTGGGGAGGG + Intergenic
1089040896 11:115448657-115448679 GGGGTAGGAGGGGGTGGGGTGGG + Intronic
1089041249 11:115452149-115452171 GGGGTGGTGGGGTGGGGGGGTGG + Intronic
1090202005 11:124864010-124864032 GGGGTAGGTGGGAGTGGGGGTGG - Intergenic
1091084913 11:132712302-132712324 GGGGGAGGAGGATGTGGGGGAGG - Intronic
1091760547 12:3084448-3084470 GGTGGAGCAGGGAGAGGGGGTGG + Intronic
1091792505 12:3280010-3280032 TGTGTAGTGGGGGGCGGGGGTGG + Intronic
1092051631 12:5474936-5474958 GGAGGAGCAGGGTTTGGGGGAGG + Intronic
1092239367 12:6827906-6827928 GGTGGATGAGTGTGTGGGGGGGG + Intronic
1094029044 12:25989778-25989800 GGTGTGGTGGGGCATGGGGGTGG + Intronic
1094078825 12:26509999-26510021 TGTGTGGTGGGGGGTGGGGGTGG + Intronic
1094608175 12:31967618-31967640 GGTGTTGTGGGGGGTGGGGGTGG - Intronic
1095945072 12:47749110-47749132 GGGGGACTAGGCTGTGGGGGAGG - Intronic
1096086153 12:48866279-48866301 GGAGGAGTAGGGGATGGGGGAGG + Intergenic
1096355573 12:50938196-50938218 TGTGTAGGGGGGTGGGGGGGTGG - Intergenic
1096514516 12:52148612-52148634 GGTGCAGTGGGGTGAGCGGGCGG + Intergenic
1096562462 12:52446496-52446518 GATGGAGTAGGCTGTGGAGGGGG + Intergenic
1097246296 12:57609523-57609545 GGTGGAGCAGTATGTGGGGGCGG - Exonic
1097456377 12:59803646-59803668 GTGGTGGTAAGGTGTGGGGGAGG + Intergenic
1097647981 12:62259993-62260015 GGTGAGGTAGGGTGGGGCGGTGG - Intronic
1097679109 12:62632516-62632538 GGTGGAGAAGAGTCTGGGGGAGG - Intergenic
1098057868 12:66527517-66527539 AGTGTTGTGGGGTGTGGGGATGG + Intronic
1098345608 12:69499783-69499805 GTTGGAGTAGGGTGGGGGTGGGG + Intronic
1098706206 12:73692979-73693001 AGGGTAGTTGGGGGTGGGGGTGG + Intergenic
1100393354 12:94163488-94163510 GGAGAAGGAGGTTGTGGGGGTGG + Intronic
1101067224 12:101034488-101034510 GGAGTAGGAGGGTGAGGGGATGG + Intronic
1101461025 12:104893862-104893884 GTAGTAGGAGGGTATGGGGGAGG + Intronic
1101634557 12:106527651-106527673 GTGGTGGTATGGTGTGGGGGAGG - Intronic
1101639030 12:106572277-106572299 GTTGTTGTAAGGTGTGAGGGAGG - Intronic
1101881450 12:108628785-108628807 GGTGCAGGAGGCTGTGGGGATGG - Intronic
1102394436 12:112574796-112574818 GGTGGAGGAGGGAGAGGGGGTGG + Intronic
1102394445 12:112574817-112574839 GGTGGAGGAGGGAGAGGGGGTGG + Intronic
1102394470 12:112574890-112574912 GGTGGAGGAGGGAGAGGGGGTGG + Intronic
1103119944 12:118372341-118372363 GGGGTAGTGGGGTGAGGGGTGGG - Intronic
1103342643 12:120229255-120229277 GCTGCAGTCGGGGGTGGGGGCGG - Intronic
1103519752 12:121530521-121530543 GGTGGGGTAGGGTGGGAGGGAGG - Intronic
1103993102 12:124812239-124812261 GCTGGAGTAGGGTGTGGTGGGGG - Intronic
1104201407 12:126593274-126593296 GGTATACAAGGGTGAGGGGGTGG - Intergenic
1105449005 13:20482026-20482048 GGTAGAGATGGGTGTGGGGGTGG - Intronic
1105565910 13:21547778-21547800 TGTGTACTTGGGGGTGGGGGTGG + Intronic
1105640150 13:22253359-22253381 CTTGAAGTAGGGTGTGGGTGGGG + Intergenic
1106003024 13:25742631-25742653 AGTGGAGTGGGGTGTGTGGGGGG - Intronic
1106136194 13:26975585-26975607 TGTGTAGGTGTGTGTGGGGGTGG - Intergenic
1106448365 13:29857388-29857410 GGTGTGGGAGGGTGTGAAGGGGG - Intergenic
1107497024 13:40936609-40936631 GGCATAGTCGGGTGTGGTGGCGG + Intronic
1108181906 13:47848742-47848764 GGTGGGGTGGGGGGTGGGGGGGG - Intergenic
1108687620 13:52834538-52834560 GTGGGAGTAGGGGGTGGGGGAGG + Intergenic
1108750954 13:53447853-53447875 TGTGTAGAACGGTGTGGGAGAGG - Intergenic
1108918298 13:55643705-55643727 GGTCTACCAGGGTTTGGGGGTGG + Intergenic
1109409734 13:61946231-61946253 CCTGTAGTGGGGTGTGGGGAAGG + Intergenic
1111039664 13:82730157-82730179 GCGGTACTAAGGTGTGGGGGAGG + Intergenic
1112333841 13:98497961-98497983 GGTGTAGTGGGGTGTGGGCTTGG - Intronic
1112334191 13:98500615-98500637 GGAGTGGTGGGGGGTGGGGGTGG - Intronic
1113165400 13:107435075-107435097 GGTTTAGTAAGATTTGGGGGTGG + Intronic
1113457619 13:110459564-110459586 GGTGGAGGTGGGGGTGGGGGTGG + Intronic
1114259408 14:21025938-21025960 GGTGGAGTAGGGGCTTGGGGAGG + Intronic
1114618471 14:24081194-24081216 GGTGTAGTGGGGGCTGGGTGGGG - Exonic
1114961242 14:27892674-27892696 GGTGGGGCAGGGCGTGGGGGAGG - Intergenic
1117157850 14:52958454-52958476 GGTGCAGCAGGGTGGGGTGGGGG - Intergenic
1117275304 14:54187840-54187862 GGTGAGGTTGGGGGTGGGGGTGG - Intergenic
1117957270 14:61132193-61132215 GATGTTGTTGGGTGTGGGAGAGG + Intergenic
1120987054 14:90343704-90343726 GGTGTGGGGGGGAGTGGGGGCGG + Intergenic
1120987065 14:90343725-90343747 GGTGTGGGGGGGAGTGGGGGCGG + Intergenic
1120987074 14:90343746-90343768 GGTGTGGAGGGGAGTGGGGGCGG + Intergenic
1121407245 14:93726465-93726487 GGTGTGGGAGGGTGTCGGGGTGG - Intronic
1121612670 14:95292438-95292460 GGTGGAGGTGGGGGTGGGGGTGG - Intronic
1122093979 14:99357822-99357844 AGTGGAGTCGGGGGTGGGGGGGG + Intergenic
1122250911 14:100439048-100439070 GGAGCAGTAGGGAGTGGGGCTGG + Intronic
1122359982 14:101153378-101153400 GCTGTGATAGGGTGCGGGGGAGG - Intergenic
1122747997 14:103911009-103911031 GGTGAGGTGGGGGGTGGGGGTGG + Intergenic
1122770074 14:104093909-104093931 GGGGCTGTAGGGTGTGGGTGGGG + Intronic
1122782665 14:104150195-104150217 GGAGGAGGAGGGGGTGGGGGAGG - Intronic
1122906818 14:104805446-104805468 GGTGTGGGAGGGGGTAGGGGAGG - Intergenic
1123040515 14:105488415-105488437 GGTGGAGGAGGCTGTGGGGTGGG - Intronic
1202858432 14_GL000225v1_random:65189-65211 GGGGTGGTGGGGTTTGGGGGAGG + Intergenic
1123722281 15:23069762-23069784 GGTGTGGGGGGGTGTGGTGGGGG + Intergenic
1123722285 15:23069772-23069794 GGTGTGGTGGGGGGTGGAGGTGG + Intergenic
1123787635 15:23688736-23688758 GGTGGAGGAGGGTGAGGAGGAGG - Intergenic
1124345406 15:28918618-28918640 GGTGGGGTTGGGGGTGGGGGTGG + Intronic
1124346804 15:28928461-28928483 GTAGTTGTAGGGTGTGGGGAGGG + Intronic
1124463486 15:29914834-29914856 TGTGTTGCAGGGTGTGGGAGAGG - Intronic
1124493557 15:30173111-30173133 CATGTAGTAGGGTGTGTGTGTGG + Intergenic
1124493566 15:30173201-30173223 CATGTAGTAGGGTGTGTGTGTGG + Intergenic
1124493578 15:30173318-30173340 TGTGTAGTAGGGTGTGTGTGTGG + Intergenic
1124645496 15:31435160-31435182 TGTGTTGTAGGCTGTGGGGGCGG + Intronic
1124749990 15:32365331-32365353 TGTGTAGTAGGGTGTGTGTGTGG - Intergenic
1125320696 15:38484471-38484493 GGGGGAGGAGGGTGGGGGGGAGG + Exonic
1125381458 15:39091623-39091645 GGAGCAGTGGGGGGTGGGGGGGG + Intergenic
1125481980 15:40087473-40087495 GGTGGGGTAGTGTGTGCGGGAGG + Intergenic
1125894293 15:43288946-43288968 GGTGGAGTGGGGAGTGGGGATGG + Intronic
1125894930 15:43293884-43293906 GGTGGGGTGGGGTGTGCGGGGGG + Intronic
1125894943 15:43293914-43293936 GGGGGAGTGGGGTGTGCGGGGGG + Intronic
1125929890 15:43593151-43593173 GGTGGTGCTGGGTGTGGGGGTGG - Exonic
1125943058 15:43692983-43693005 GGTGGTGCTGGGTGTGGGGGTGG - Intronic
1127117708 15:55743569-55743591 GGTGTAGGAGGGGGTGGGCGGGG - Intergenic
1127385286 15:58461926-58461948 GGTGGAGTGGGATGTGGGGGCGG - Intronic
1128096590 15:64960940-64960962 GGTGGAGGAGTGAGTGGGGGTGG + Intergenic
1128126279 15:65195383-65195405 AGGGTAGTGGGGTGTGGGGTTGG - Exonic
1129182309 15:73885134-73885156 GGAGTAGTGGGGGGTTGGGGAGG - Intronic
1129208911 15:74054147-74054169 GGGGTAGAGGGGGGTGGGGGTGG + Intergenic
1129367605 15:75066157-75066179 AGTGGACTGGGGTGTGGGGGTGG - Intronic
1129759853 15:78123101-78123123 GGTGTTGATGGGGGTGGGGGTGG - Intronic
1129999056 15:80031708-80031730 GGTGGAGTAGGGATTGGAGGTGG - Intergenic
1130619541 15:85447520-85447542 GGTCTATTTGGGGGTGGGGGAGG - Intronic
1130626682 15:85522908-85522930 GGTGTGGGTGGGGGTGGGGGGGG - Intronic
1130910375 15:88266445-88266467 GGTGCGGTGGGGTGTGGGTGAGG + Intergenic
1131007982 15:88994085-88994107 GGTGTAGGGGGGTGTGGGGGTGG - Intergenic
1131285158 15:91050737-91050759 GGTGGGGTGGGGTGTGGGAGAGG + Intergenic
1132055395 15:98647903-98647925 GGCGTAGTAGCCTGGGGGGGGGG + Intergenic
1132931606 16:2461625-2461647 GGTGGGGTCGGGTGTGGGAGAGG + Intronic
1133057194 16:3151307-3151329 TTTTTAGTAGGGTGGGGGGGTGG + Intergenic
1133381598 16:5335664-5335686 GGAGTGGCACGGTGTGGGGGTGG + Intergenic
1133405535 16:5521356-5521378 GGTGGGGTGGGGTGGGGGGGTGG + Intergenic
1134132046 16:11656625-11656647 GGAGGGATAGGGTGTGGGGGTGG + Intergenic
1134391247 16:13822295-13822317 GGTATTGGAGGGTTTGGGGGTGG - Intergenic
1134405589 16:13955963-13955985 GATGTAGTAGGGGTTGGGCGTGG + Intergenic
1135275374 16:21108011-21108033 GGTGTGGTGGTGGGTGGGGGCGG - Intronic
1135518222 16:23152872-23152894 GGTGGTGTACAGTGTGGGGGTGG + Intergenic
1135621366 16:23958733-23958755 GGGGTGGAAGGGAGTGGGGGAGG - Intronic
1135924921 16:26685203-26685225 CCTGTTGTAGGGTGGGGGGGGGG - Intergenic
1136024740 16:27462255-27462277 GGTTCAGCAGGGTGTGGAGGCGG - Intronic
1136371283 16:29837904-29837926 GATGAAGTAGGGGGTGGGAGAGG - Intronic
1136688036 16:32007518-32007540 GGTGTAGTAGGAAGAGAGGGAGG + Intergenic
1136788640 16:32951073-32951095 GGTGTAGTAGGAAGAGAGGGAGG + Intergenic
1136881172 16:33902861-33902883 GGTGTAGTAGGAAGAGAGGGAGG - Intergenic
1137290201 16:47047198-47047220 GGAGTAGTAGAGGATGGGGGAGG + Intergenic
1137501652 16:49016052-49016074 GGTGCAGGTGTGTGTGGGGGGGG + Intergenic
1137675647 16:50302557-50302579 GGTGGGGTAGGGTGGGGTGGGGG - Intronic
1137734109 16:50711537-50711559 GGTGCAGGAGGGTGGGGAGGCGG - Exonic
1138503369 16:57462889-57462911 GGTGTAGTGGGGTGGGGTGGGGG + Intronic
1140035454 16:71368132-71368154 GCTGTAATGGGGTGTGGGTGGGG - Intronic
1140279762 16:73543826-73543848 GCTGGAGAAGGGGGTGGGGGAGG + Intergenic
1141430017 16:83966521-83966543 GCTGTACTAGAGTCTGGGGGTGG + Intergenic
1141558650 16:84852650-84852672 GGTGAGTTTGGGTGTGGGGGGGG + Intronic
1141581811 16:85004527-85004549 GGTGGAGTGGGGGGTGGGGTGGG - Intronic
1141601195 16:85127261-85127283 GGTGGGGTAGGGAGCGGGGGAGG + Intergenic
1141688730 16:85584807-85584829 GGCTGAGCAGGGTGTGGGGGTGG + Intergenic
1141919859 16:87128446-87128468 GGTGAAGCAGGGTGTGGAAGGGG - Intronic
1142240352 16:88941846-88941868 GGAGTTGGGGGGTGTGGGGGGGG + Intronic
1142248974 16:88982565-88982587 GGGGGAGGAGGCTGTGGGGGAGG - Intergenic
1142416616 16:89946780-89946802 GGTGAAGGTGGGGGTGGGGGTGG + Intergenic
1203090837 16_KI270728v1_random:1212562-1212584 GGTGTAGTAGGAAGAGAGGGAGG + Intergenic
1143795659 17:9334134-9334156 GGTGCGGGGGGGTGTGGGGGTGG + Intronic
1144872709 17:18380786-18380808 AGTGTGCTAGGCTGTGGGGGCGG + Intronic
1144945543 17:18967868-18967890 GGTGTGGTGGGGGGTGGGGGCGG - Intronic
1145776132 17:27530303-27530325 GGTGTAGTTGTGTGTGGCAGTGG + Intronic
1146242171 17:31240216-31240238 AGTGTAGTGGGGGGTGGGGAAGG - Intronic
1147042145 17:37727315-37727337 GCTGGAATAGGGGGTGGGGGCGG + Intronic
1147149022 17:38503201-38503223 GGTGTAGTAGGAAGAGAGGGAGG + Intronic
1147256658 17:39185772-39185794 GGTGGAGTTGTGTGTGGAGGGGG + Intronic
1147425214 17:40342890-40342912 GCTGTTGTAGGGGGTGGGAGTGG + Intronic
1147925058 17:43941040-43941062 GGTGTAGTGGGGGGTGGAAGAGG - Intronic
1148128511 17:45248714-45248736 GGTGAAGGAGGGTGAGGAGGGGG + Intergenic
1148139042 17:45315753-45315775 TGTGTATGAGGGAGTGGGGGTGG - Intronic
1148174343 17:45550578-45550600 GGTGGGGTAGGGTGGGGTGGGGG + Intergenic
1148217348 17:45840322-45840344 GGGGCAGTAGGGTGGGGGGAGGG + Intergenic
1148274919 17:46294869-46294891 GGTGGGGTAGGGTGGGGTGGGGG - Intronic
1148297026 17:46512448-46512470 GGTGGGGTAGGGTGGGGTGGGGG - Exonic
1149390746 17:56187930-56187952 CGTGGGGTAGGGGGTGGGGGAGG + Intronic
1149560528 17:57604948-57604970 GGTGTATTTGTGTGTGGGGAGGG + Intronic
1149628095 17:58094398-58094420 GGTGCAATAGGGTGTGAGGGGGG - Exonic
1149639044 17:58191432-58191454 GTTTCGGTAGGGTGTGGGGGTGG + Intergenic
1149660901 17:58333402-58333424 AGGGGAGTAGGGTGTGGGGGTGG + Intergenic
1149895063 17:60422643-60422665 GGTGAAGTGGGGTGTGAGGGAGG + Exonic
1150050804 17:61960418-61960440 GATGTAGCCGGGTGTGGTGGTGG - Intronic
1150929769 17:69572094-69572116 GGTGTGGCAGTGTGTGGGTGGGG + Intergenic
1151135973 17:71945983-71946005 GGTTTTATAGTGTGTGGGGGGGG + Intergenic
1151514030 17:74580659-74580681 GGTGGAGGATGGTGAGGGGGTGG - Intronic
1151850038 17:76684774-76684796 GGGGCAGTGGGGTGTGGAGGGGG + Intronic
1151943496 17:77306882-77306904 GGGGTAGTAGGGCTTGGGGGAGG + Intronic
1151996462 17:77612340-77612362 GGTGTAGATGGGTGTGGCTGTGG + Intergenic
1152146669 17:78572619-78572641 GGTGGAGTGGGGTGGGGGGTGGG + Intronic
1152232944 17:79124000-79124022 TGTGCAGTAGAGTGTGTGGGAGG - Intronic
1152236860 17:79143366-79143388 GGTGGAGCGGGGGGTGGGGGGGG + Intronic
1152318800 17:79596441-79596463 GGGGTAGGAGGGTGTGCCGGAGG - Intergenic
1153528707 18:6021756-6021778 GGTGCAGCGGGGTGGGGGGGTGG + Intronic
1153614294 18:6920436-6920458 GTTGTGGTAGTGTGTGGTGGTGG + Intergenic
1154283210 18:13027013-13027035 GTTGTGGTAAGGTGTTGGGGAGG + Intronic
1155473497 18:26214782-26214804 GGTGTGGTAGGGTGTCTGAGGGG + Intergenic
1155925469 18:31651177-31651199 GGTGTGGCAGGTTGAGGGGGTGG - Intronic
1156290858 18:35747769-35747791 GGTGGAGGCGGGGGTGGGGGTGG + Intergenic
1157191553 18:45586338-45586360 AGTGTAGTGAGGAGTGGGGGAGG + Intronic
1157490793 18:48122413-48122435 GCTGCAGTAGGGTATGAGGGAGG + Intronic
1157782633 18:50453613-50453635 GGTGTAGTTAGGAGTGGGGTGGG + Intergenic
1158115687 18:53992741-53992763 GGTGTATTAGTTTGTTGGGGTGG - Intergenic
1158421836 18:57301803-57301825 AATGCAGCAGGGTGTGGGGGCGG - Intergenic
1158703561 18:59770870-59770892 AGTGGAGTAGGGGGTGAGGGAGG - Intergenic
1158718753 18:59904672-59904694 AGTGTGGTGGCGTGTGGGGGAGG - Intergenic
1158841409 18:61392177-61392199 GCTGGAGTAGGGGGTGGGGTGGG - Intronic
1158945305 18:62442520-62442542 GATGCAGGATGGTGTGGGGGAGG - Intergenic
1159448974 18:68575983-68576005 TGTGTAGGGGGGTGTGGGAGGGG - Intergenic
1160125558 18:76168623-76168645 TTTGGAGTAGGGTGTGGGGGAGG - Intergenic
1160632923 18:80258815-80258837 GGTGGGGTAGGGTTTGGGGTAGG + Intergenic
1160832598 19:1110700-1110722 GGTGTGGGTGGGTGTGGGTGCGG - Intronic
1160961058 19:1721023-1721045 GGTGAGGGAGGGAGTGGGGGCGG - Intergenic
1161253717 19:3294966-3294988 GGTGGAGTAGGGTGGGGAGGTGG + Intronic
1161258633 19:3323399-3323421 TGTGTGGTGGGGTGTGGGGCGGG - Intergenic
1161394604 19:4038443-4038465 GGGGCAGTAGGGTGGGGGGATGG + Exonic
1161731728 19:5964840-5964862 GAGGTGGTAGGGTGGGGGGGGGG + Intronic
1162145969 19:8612075-8612097 GCTGGAGTAGGGGGTGGAGGAGG + Intergenic
1162455277 19:10780311-10780333 GCTGTAGTAGGGCGTGGGGTTGG - Intronic
1162907297 19:13831464-13831486 TGAGCAGTAGGGGGTGGGGGAGG - Exonic
1163002130 19:14375233-14375255 GGTGACGTGGGGTGGGGGGGCGG - Intergenic
1163166046 19:15499005-15499027 GGTGCAGTAGGGGGTGGGGGTGG + Intergenic
1163295901 19:16412699-16412721 GGTGCAGCGGGGGGTGGGGGGGG + Intronic
1163560638 19:18017382-18017404 ACTGTGGTAGGGTGTGGGGATGG - Intergenic
1164220278 19:23187230-23187252 GCTGGGGTAGGGGGTGGGGGGGG - Intergenic
1164432087 19:28197527-28197549 GGCGTGGTGGGGGGTGGGGGTGG - Intergenic
1164441099 19:28281628-28281650 GGTGAAGGAGGGTGTGGGGAAGG - Intergenic
1164597128 19:29537695-29537717 AGAGTAGGTGGGTGTGGGGGCGG - Intronic
1165414067 19:35680540-35680562 GGTGTAGTAGTGTGTGCCTGTGG + Intergenic
1166010094 19:39935302-39935324 GGTGGGGTAGGGTGGGGGTGTGG + Intergenic
1166078015 19:40425399-40425421 GGCGGAGTCGGGGGTGGGGGCGG - Intronic
1166432217 19:42737398-42737420 GGTGGTGTAGGGTGTGAGTGGGG + Intronic
1166762189 19:45231933-45231955 TGGGTAGGAGGGTGTGGGGAAGG - Intronic
1166768316 19:45265483-45265505 GGTGTGTAAGAGTGTGGGGGGGG + Intronic
1166892133 19:46000206-46000228 GGTGGAGTGGGGGTTGGGGGTGG + Intronic
1167373963 19:49101546-49101568 GGTGTGGCAGGGTGGGGGAGGGG - Intronic
1167643132 19:50692978-50693000 GGTGCAGGAGGGTGTGGGAAGGG - Intronic
1167725664 19:51211301-51211323 GTTGTAGTAGGGTATGGGATGGG - Intergenic
1167886181 19:52501704-52501726 GGTGCAGTGGGCAGTGGGGGGGG + Intronic
1168237392 19:55071903-55071925 CGTGTAGCAGCGGGTGGGGGAGG - Intergenic
1202676822 1_KI270711v1_random:14735-14757 CCTGTTGTAGGGTGTGGGGAGGG - Intergenic
1202706364 1_KI270713v1_random:27174-27196 GGGGTGGCAGGGGGTGGGGGTGG + Intergenic
925129800 2:1486791-1486813 GGCGTAGTGGGGAGTGGGGAGGG + Intronic
925313766 2:2906694-2906716 GGTGGAGGAAGGTGTAGGGGTGG - Intergenic
925313784 2:2906740-2906762 GGTGGAGGAAGGTGTAGGGGTGG - Intergenic
925420140 2:3704355-3704377 TGTGGAGGAGGGCGTGGGGGAGG + Intronic
925436898 2:3846246-3846268 GGAGAAGAAGGGAGTGGGGGAGG - Intronic
925508894 2:4602698-4602720 GGTGGGGTAGGGTGGGGGGAGGG - Intergenic
925940637 2:8814499-8814521 GATAGAGTAGGGTGTGGGGAAGG + Intronic
926179174 2:10625344-10625366 GGTGAGGGAGCGTGTGGGGGAGG + Intronic
926904629 2:17794403-17794425 GGTGGGGTGGGGAGTGGGGGCGG - Intronic
928082801 2:28325708-28325730 GGTGTTTGAGGATGTGGGGGAGG - Intronic
928246927 2:29638507-29638529 GATGGAGTAGGGTGGGGGTGGGG + Intronic
929444693 2:41992654-41992676 GGTGTATTATGGTGGGGGAGGGG - Intergenic
929481993 2:42317874-42317896 GATGTTGTAGGGTGTTGAGGTGG - Intronic
929862626 2:45692745-45692767 GGTGGAGTGGGGTGTGTGTGGGG - Intronic
930097802 2:47580231-47580253 GGTGCAGTTAGGTGTGGGGATGG + Intergenic
930564456 2:53002123-53002145 AGGGTAGTGGGGTGTGGTGGGGG - Intergenic
931251049 2:60530812-60530834 GGGGTAGTGGGAGGTGGGGGAGG - Intronic
932759972 2:74432853-74432875 GGTGCAGTGGTGTGTGAGGGAGG + Intronic
934095173 2:88595133-88595155 GGTGTGGAATGGGGTGGGGGTGG + Intronic
934993968 2:98940158-98940180 GGTGTTGGCGGGGGTGGGGGGGG - Intergenic
936023100 2:109010321-109010343 GGTGTTGAAGGCTGGGGGGGTGG - Intergenic
936105110 2:109615983-109616005 GGGGGAGGAGGGAGTGGGGGAGG + Exonic
936577285 2:113667630-113667652 GGTGTAGGTGGGGGTGGGGGTGG + Intergenic
937865554 2:126748814-126748836 TGTGTGGTGGGTTGTGGGGGAGG - Intergenic
937895336 2:126973489-126973511 TGTGGAGCAGGGTGTGGGTGTGG - Intergenic
938218187 2:129541040-129541062 CCTGTTGTAGGGTGGGGGGGAGG + Intergenic
938886215 2:135651874-135651896 GGTGGAGGAGGATGTGGTGGAGG - Exonic
940577833 2:155535765-155535787 GGGGTTGTAGTGTCTGGGGGAGG - Intergenic
940864107 2:158799912-158799934 GGTTTAGCTGGGTGTGGTGGCGG + Intronic
941178691 2:162233053-162233075 GTGGTAGTGGGGTGAGGGGGTGG - Intronic
941714399 2:168748817-168748839 GGCGTGGTTGGGGGTGGGGGGGG + Intronic
944153892 2:196591631-196591653 GGTGGGGTAGGGTGGGGTGGAGG - Intronic
944168022 2:196743544-196743566 GGGGTGGGAGGGGGTGGGGGTGG - Intronic
944517677 2:200528526-200528548 GGTGGAGTAGGTTGGGGTGGGGG + Intronic
944822053 2:203441037-203441059 GGTGGAGGAGGGGGAGGGGGTGG + Exonic
944822109 2:203441274-203441296 GGTGGAGGAGGAGGTGGGGGTGG + Exonic
946190959 2:218007763-218007785 GGTGTATGAGGGTGAGGGGTAGG - Intergenic
947726255 2:232402697-232402719 GGTGTGGTGGGGAGTGGGGTAGG + Intergenic
947966794 2:234288986-234289008 GGTGGAGAAGGGCGCGGGGGTGG - Intergenic
948478328 2:238235417-238235439 GGTGTCACTGGGTGTGGGGGCGG + Intergenic
948537405 2:238656442-238656464 GGTCTAGTTGGGGGTGGGGCAGG - Intergenic
948720874 2:239899208-239899230 GGTGTGGAGGGGTGTGGTGGAGG + Intronic
948858514 2:240741772-240741794 GGTGTAGTAGGCTGTGGCCAAGG - Intronic
948916177 2:241035966-241035988 GGCGTAGTAGGGGTGGGGGGCGG + Intronic
949022449 2:241749174-241749196 GGTGTTGGAGGGTCTGGCGGTGG - Intronic
1168800791 20:642339-642361 GGTGGAGTTGCCTGTGGGGGGGG + Intergenic
1169908734 20:10629727-10629749 AGTGAAGTAGGCTGTGGGAGGGG + Intronic
1171903823 20:30883022-30883044 CCTGTTGTGGGGTGTGGGGGGGG - Intergenic
1172033768 20:31998021-31998043 GGTGGGGCAGGGTGTTGGGGTGG + Exonic
1172304667 20:33872348-33872370 GGAGGAGTTGGGGGTGGGGGTGG + Intergenic
1172749917 20:37243655-37243677 GGGGTAGTAGGGCCTGAGGGTGG + Intergenic
1172983997 20:38967928-38967950 GTTGTAATGGGGGGTGGGGGAGG - Intronic
1173569736 20:44068481-44068503 GGTGTAGAGGTGGGTGGGGGTGG + Intronic
1173836548 20:46129726-46129748 GGGGAAGAAGGGTCTGGGGGAGG + Exonic
1174812624 20:53660111-53660133 AGTGTGGCAGGGTGTGGGCGGGG + Intergenic
1175158398 20:56989949-56989971 GGGGTAATTGTGTGTGGGGGGGG + Intergenic
1175224879 20:57439226-57439248 GGGGTAGGAGGGTGGGGGTGTGG - Intergenic
1175257252 20:57654944-57654966 GGAGTGGCAGGGTGTGGGGTGGG - Intronic
1175479281 20:59300367-59300389 GGTGGGGTAGGGTGGGGTGGGGG - Intergenic
1175667119 20:60870257-60870279 TGTGTATTTGTGTGTGGGGGTGG - Intergenic
1175973074 20:62696868-62696890 GGTGGGGTGGGGTGTGGGTGGGG + Intergenic
1176241679 20:64078488-64078510 GGGGTGCTAGAGTGTGGGGGAGG - Intronic
1176694100 21:9952857-9952879 GGTATAGTAGGAGGTGGGTGAGG - Intergenic
1177773502 21:25543612-25543634 GAGGGAGTCGGGTGTGGGGGAGG + Intergenic
1179383954 21:40924572-40924594 GTGGTACTAGGGAGTGGGGGAGG + Intergenic
1179442706 21:41406480-41406502 GGTGTAGGAGGGACTGGGGATGG + Intronic
1179874914 21:44262550-44262572 GGGGGATTAGGGAGTGGGGGTGG + Intergenic
1179881223 21:44294106-44294128 TGGGGAGTAGGGTGTGGGTGGGG - Intronic
1179883167 21:44301866-44301888 GGGGTGGCAGGGGGTGGGGGGGG - Intronic
1180081578 21:45489967-45489989 AGTGGGGGAGGGTGTGGGGGAGG - Intronic
1180081597 21:45490008-45490030 AGTGGGGGAGGGTGTGGGGGAGG - Intronic
1181100753 22:20537285-20537307 GGTGTCCTAGGGTGTAGGGGTGG + Intronic
1182468074 22:30530538-30530560 GGCGTAGTGGTGTGTGGGGGTGG - Intronic
1182656278 22:31892725-31892747 GGGGCAGCAGGTTGTGGGGGTGG - Intronic
1183062306 22:35343865-35343887 GGTGTATGAGTGTGTAGGGGTGG - Intronic
1183220671 22:36510605-36510627 CGTGAAGCAGGGTGTGGGTGAGG - Intergenic
1183487597 22:38097775-38097797 GGTGAAGTAGGAGATGGGGGAGG + Intronic
1184113486 22:42408977-42408999 TGTGTGGGAGGGTGTGTGGGAGG + Intronic
1184168294 22:42743491-42743513 GGATCAGTAGTGTGTGGGGGTGG + Intergenic
1184944971 22:47796377-47796399 GGTGTAATGGCGTGTGTGGGAGG + Intergenic
1185422943 22:50745034-50745056 GGTGTAGGTGGGGGTGGGGGTGG - Exonic
949915813 3:8963520-8963542 GTTGTAGTAGTATGTGGGCGGGG + Intronic
949920872 3:8999538-8999560 GATGAAGTAGGGGGTGGGGTAGG - Intronic
950215054 3:11153495-11153517 GGTGGGTTGGGGTGTGGGGGTGG - Intronic
950361244 3:12450802-12450824 GGCATAGCAGTGTGTGGGGGAGG + Intergenic
951146400 3:19233062-19233084 TATGTAGTGGGGTGGGGGGGGGG - Intronic
951250900 3:20393491-20393513 AGTGTAGTAGGGTGTGGGGTAGG + Intergenic
951473425 3:23080012-23080034 ATTGTAGAAGAGTGTGGGGGAGG + Intergenic
951899312 3:27641319-27641341 GGTGGAAGAGGGTGTGGGGGAGG + Intergenic
951901744 3:27664175-27664197 TGTGGACTAGGGTGTGTGGGAGG - Intergenic
952428282 3:33197624-33197646 GGGGTAGTATGGAGTAGGGGAGG - Intronic
952748296 3:36802711-36802733 GGTATTGTTGGGTTTGGGGGAGG + Intergenic
953921295 3:46953871-46953893 GGTGGGGTAGGGTGAGAGGGTGG - Intronic
954369973 3:50165101-50165123 GGTGGAGTAGGGTCAGGAGGAGG + Intronic
955175598 3:56611080-56611102 GCTGTAGTAGTGTGTGGAGAGGG + Intronic
955234961 3:57131130-57131152 GAGGTAGGAGGGGGTGGGGGAGG - Intronic
955605249 3:60694907-60694929 CCTGTTGTGGGGTGTGGGGGTGG + Intronic
955971022 3:64438787-64438809 GGCGTTTTAGGGGGTGGGGGTGG - Intronic
956976781 3:74589950-74589972 AGTGTTGTGGGGTGGGGGGGAGG + Intergenic
957152026 3:76498296-76498318 GGCGCAGTAGGGTGTGGGGTTGG + Intronic
959182360 3:102997729-102997751 AGTGTAGCAGGGGGTGGGTGGGG + Intergenic
959239167 3:103766629-103766651 GGTGTCGTGGGGTGGGGGGATGG + Intergenic
960108153 3:113819972-113819994 GGTGCAGTTGGGTGTGTGGGTGG - Intergenic
960166753 3:114411208-114411230 GCTGTTGAAGGGTGTGGGGAAGG - Intronic
960481181 3:118191828-118191850 TGTGGGGTAGGGGGTGGGGGAGG - Intergenic
961033115 3:123623667-123623689 GGTGGAGTGGGCTGTGGGCGGGG - Intronic
961063132 3:123849891-123849913 CCTGTTGTAGGGTGTGGGGAGGG - Intronic
961683472 3:128614284-128614306 GGTGTAGCAGGGTGTGGGCTGGG - Intergenic
961723368 3:128910231-128910253 GGTGTGGTCGGGTGTGGGGGAGG + Exonic
961796883 3:129415511-129415533 GGTATAGTAGGGAGTGGTTGAGG - Intronic
962306293 3:134289618-134289640 GTTGTTGGAGGGTATGGGGGTGG - Intergenic
962349361 3:134645221-134645243 GGGGTAGGAGGGTGAGGAGGCGG + Intronic
962466876 3:135668781-135668803 ACTGTTGTAGGGTGTGGGGACGG - Intergenic
963029153 3:140950246-140950268 GGGGCAGTGGGGGGTGGGGGCGG - Intronic
963586809 3:147201917-147201939 GGGGTGGTAGGGAGTGGGGAAGG - Intergenic
963731659 3:148980603-148980625 GGTGTGATAGGGTGTGATGGTGG - Intergenic
964201219 3:154121369-154121391 GGCGTAGTCAGGCGTGGGGGCGG + Intronic
964282224 3:155079616-155079638 GGCGGGGTAGGGGGTGGGGGGGG + Intronic
964365824 3:155950015-155950037 GGTCGGGGAGGGTGTGGGGGAGG - Intergenic
964428692 3:156580852-156580874 TGTGTAGAAGGGTGTGGGTGGGG - Intergenic
964689231 3:159431285-159431307 TGTGTGGGAGGGTGTGGTGGGGG + Intronic
964871618 3:161319274-161319296 GGGGAAGTGGGGTGGGGGGGGGG + Intergenic
965630426 3:170726977-170726999 GGTGGAGGAGGGTGTGGGTAGGG + Intronic
966013992 3:175118108-175118130 CCTGTCGTAGGGTGGGGGGGAGG + Intronic
966073659 3:175909013-175909035 GGTGGAGTGGGGGGAGGGGGTGG + Intergenic
966240812 3:177753631-177753653 GGTGAAGATGGGTGTGGGGAAGG + Intergenic
966274855 3:178153129-178153151 GGTTTAGAAGGGTGAGGGGGAGG - Intergenic
966916644 3:184587942-184587964 GGAGTGGCAGGGTGTGTGGGAGG - Intronic
967576263 3:191097094-191097116 GGTGTAGGAGGGTGAGGGGATGG - Intergenic
967931561 3:194694081-194694103 TGGGGAGTAGGGGGTGGGGGGGG - Intergenic
968522515 4:1040352-1040374 GCTGTAGTTGTGTGTGGGGCTGG + Intergenic
969156692 4:5217377-5217399 GGTGAAGGAGGCGGTGGGGGAGG + Intronic
969355215 4:6621065-6621087 GGTGCAGGAGGGTGAGAGGGAGG + Intronic
971726434 4:30318550-30318572 CCTGTCGTAGGGTGTGGGGAGGG + Intergenic
972420396 4:38881340-38881362 AGTGTTGTAGGGGGTGGGGAAGG - Intronic
972587200 4:40448915-40448937 GGTGAAGGAGGGGGTGGGGTAGG + Intronic
972706882 4:41553517-41553539 GATGAGGTAGGGTGTGGTGGGGG + Intronic
974193590 4:58540167-58540189 GTGGTAGTATGGTGTGAGGGAGG + Intergenic
975573259 4:75838865-75838887 GCAGGAGGAGGGTGTGGGGGAGG + Intergenic
975610510 4:76198085-76198107 GGTGGAGTCGAGAGTGGGGGCGG - Intronic
976094586 4:81494846-81494868 GGTGTAGCCGGGTGTGGTGGCGG - Intronic
976786097 4:88823328-88823350 GAAGGAGTAGGGTGCGGGGGAGG - Intronic
978615117 4:110586644-110586666 GGTGGGGTAGGATGTGGTGGGGG + Intergenic
981319616 4:143376106-143376128 GGTGGTGTAGGGGGTTGGGGAGG - Intronic
982550826 4:156797337-156797359 GTTGAAGTGGGGTGTGGGCGAGG - Intronic
982868407 4:160546266-160546288 GGGGTTGTGGGGTGGGGGGGGGG - Intergenic
983231621 4:165134800-165134822 GGGGTAGTAGGCTATGGGTGGGG + Intronic
983581474 4:169313587-169313609 GGTTTACTAGGGGGTGGAGGTGG - Intergenic
983876600 4:172883784-172883806 GGAATAGAAGGGAGTGGGGGTGG - Intronic
984501787 4:180566533-180566555 GGTGTATGTGGGTGTGGGTGAGG + Intergenic
985655940 5:1131363-1131385 GCTGCTGAAGGGTGTGGGGGAGG + Intergenic
985896456 5:2752101-2752123 GGTGGAGAAGGGGGTGGGGGCGG - Intergenic
986818830 5:11443346-11443368 TGTGTGGGAGGGTGTGTGGGGGG + Intronic
987039754 5:14051268-14051290 GGTTTAGTTGGGTGAGAGGGAGG + Intergenic
987045873 5:14107667-14107689 GGTTGACTAGGGTGTGGTGGTGG - Intergenic
988528049 5:32003465-32003487 TGTGTAGTGTGGTGTGGGGGGGG - Intronic
989118830 5:37983111-37983133 GGTCTAGCTGGGTGTGGTGGTGG - Intergenic
989189971 5:38661121-38661143 GGTGGAGCAGGGGGTGGGGGTGG + Intergenic
990755322 5:59062841-59062863 AGTGTTATAGGGGGTGGGGGTGG - Intronic
990909232 5:60837295-60837317 GGCGTGGTAGGGCGGGGGGGTGG + Intronic
990909248 5:60837319-60837341 GGGGGAGTGGGGGGTGGGGGTGG + Intronic
991576921 5:68114190-68114212 GGTGTGGTAGGAAGTGAGGGAGG + Intergenic
994437087 5:99750232-99750254 GGTGCAGGTGGGTGTGGGGTTGG - Intergenic
995720276 5:115123238-115123260 CCTGTTGTGGGGTGTGGGGGAGG + Intergenic
995721456 5:115138963-115138985 AATTTAGTAGGGTGTGGTGGCGG - Intronic
996936613 5:128956857-128956879 CCTGTAGTGGGGTGTGGGTGGGG - Intronic
997857896 5:137389937-137389959 GGTGGAGTAGGATGGGGCGGGGG - Intronic
997900883 5:137763151-137763173 GGTGGAGTTGGGGGTGGTGGGGG - Intergenic
998451212 5:142235817-142235839 GTTGGAGCAGGGAGTGGGGGTGG + Intergenic
998501895 5:142640414-142640436 GGTGGAGTATGGTGGGGGGGGGG + Intronic
998541415 5:142985654-142985676 CCTGTTGTAGGGTGGGGGGGAGG - Intronic
998957662 5:147453804-147453826 GGTGGAGGAGGGTGTGCGTGGGG - Intronic
999672106 5:153966887-153966909 GGTGTGGTTGGGTGTGGTGAGGG - Intergenic
999734030 5:154499193-154499215 GATGTAATAGGCTGTGAGGGAGG - Intergenic
1000416168 5:160986106-160986128 GGTGTGGGAGGGTGAGGGGAGGG - Intergenic
1001226981 5:169953181-169953203 GGTGTGGCTGGGTGTGGTGGTGG + Intronic
1001538223 5:172514771-172514793 GTAGTGGTAAGGTGTGGGGGAGG - Intergenic
1001732020 5:173967721-173967743 GGTGTCGGAGGGTGAGGAGGAGG + Intergenic
1001971355 5:175957428-175957450 GGGGGTGTAGGGTCTGGGGGAGG - Intronic
1002246087 5:177886349-177886371 GGGGGTGTAGGGTCTGGGGGAGG + Intergenic
1003006673 6:2389223-2389245 TGTGTATTAGGGTCTGGGTGTGG - Intergenic
1003474283 6:6467232-6467254 TGTGTAGGAGGATGTGGAGGTGG - Intergenic
1003911865 6:10750424-10750446 GGTTTAGAATGGGGTGGGGGGGG + Intronic
1004148009 6:13088297-13088319 GGGGTAGTGGGGCGTGGTGGGGG - Intronic
1004338574 6:14786688-14786710 TGTGGAGTTGGGTGTGGGGAGGG - Intergenic
1004782309 6:18923208-18923230 AGAGTAGTAGGGGGTGGGGTAGG - Intergenic
1004854030 6:19731268-19731290 GGTGCAGGGGGCTGTGGGGGTGG - Intergenic
1004924236 6:20402989-20403011 GATGGAGAAGGGGGTGGGGGAGG + Intronic
1005040216 6:21594629-21594651 GGTGGAGCCGGGCGTGGGGGAGG - Exonic
1005191372 6:23228199-23228221 GGTGGAGATGGTTGTGGGGGCGG + Intergenic
1005348408 6:24911466-24911488 GGTGGTGTATGGGGTGGGGGCGG + Intronic
1005893153 6:30156405-30156427 GTGGTGGTAGGGTGTGGGGGAGG - Intronic
1006612538 6:35303055-35303077 GGTGCGGTAGGGGTTGGGGGTGG - Intronic
1006633489 6:35446057-35446079 GGTGCAGCAGGTTGTGGGTGAGG + Intergenic
1006645460 6:35511993-35512015 GGTGTAGAAGGGGGTGGCGTTGG - Intronic
1006914005 6:37583116-37583138 GGTGGAGAAGGCTGTGGGAGGGG - Intergenic
1006980127 6:38140975-38140997 GGTGTGGGTGGGGGTGGGGGCGG - Intronic
1007081506 6:39108409-39108431 GAGGTAGATGGGTGTGGGGGTGG + Intronic
1007178606 6:39912864-39912886 GGAGCAGGAGGGTGTGGGGCAGG - Intronic
1007259912 6:40556210-40556232 GGTGTAGGAGGGGCTGTGGGAGG - Intronic
1007380697 6:41488508-41488530 TGTGTAGGAGGGGCTGGGGGCGG - Intergenic
1007382458 6:41499589-41499611 GGGGTAGAAGGGACTGGGGGTGG - Intergenic
1007395090 6:41573234-41573256 GGTGGAGTGGGGGGTGGGAGAGG - Intronic
1007662339 6:43494599-43494621 GGTTTAGTTTGGGGTGGGGGTGG + Intronic
1007729576 6:43937777-43937799 GGTGTAGGAGTGTGTGTGTGGGG - Intergenic
1007914335 6:45546977-45546999 GGTGTGGTAGTGAGTGGTGGCGG - Exonic
1009428403 6:63539954-63539976 AGTGTTGGAGGGTTTGGGGGTGG + Intronic
1009439311 6:63657602-63657624 TGTTTAGTAGGTTGTGGAGGAGG + Intronic
1010268532 6:73894225-73894247 GGTGGGGTGTGGTGTGGGGGTGG + Intergenic
1010334755 6:74667378-74667400 GGTGGAGTAGGGGGAGTGGGTGG - Intergenic
1010489125 6:76452929-76452951 GGTGGAGTGGGGTGGGGGTGGGG + Intergenic
1011083734 6:83516106-83516128 GTAGTAGTAGGGAGTGGCGGAGG - Intronic
1011664736 6:89623008-89623030 GGGGGAGTGGGGGGTGGGGGGGG + Intronic
1011666677 6:89641366-89641388 AGTGCAGTAGGGGGAGGGGGAGG + Intergenic
1012328632 6:97956831-97956853 AGTGTGGTAAGGTGTGGGAGGGG + Intergenic
1012479777 6:99653684-99653706 CTTGTAGTAGGGTGGGGGGTGGG - Intergenic
1012943157 6:105438524-105438546 GGTGAAGAAGGGTGAGAGGGAGG - Intergenic
1013267344 6:108512676-108512698 GGTGAGGTAGGGTTAGGGGGTGG - Intronic
1013428409 6:110035086-110035108 GGGGTAGGATGGGGTGGGGGTGG - Intergenic
1013474878 6:110497900-110497922 GGTGTAGCAGAGAGTGGAGGAGG + Intergenic
1014935464 6:127380444-127380466 GGAGGGGTTGGGTGTGGGGGAGG - Intergenic
1015089531 6:129338962-129338984 GGTGAAGGCGGGGGTGGGGGTGG + Intronic
1015717404 6:136206674-136206696 GGTACAGGAGGGGGTGGGGGTGG + Intergenic
1015815968 6:137211105-137211127 GGAGAAGAAGTGTGTGGGGGAGG + Intronic
1017230631 6:152069577-152069599 GGTGGTGTAGGGTGGGGTGGGGG + Intronic
1017450698 6:154552081-154552103 GGTGGAGTGGGGTGGGGGCGGGG - Intergenic
1017509762 6:155104044-155104066 GGTGTGTGGGGGTGTGGGGGGGG - Intronic
1017777403 6:157690961-157690983 AGTCGAGAAGGGTGTGGGGGTGG - Intergenic
1018143034 6:160858808-160858830 GGGGTGGCAGGGTGGGGGGGGGG - Intergenic
1018682418 6:166275348-166275370 GGTGTTGTGGGATGTGGAGGAGG + Intergenic
1018746572 6:166766995-166767017 GGTGCAGCAGGGTTCGGGGGTGG - Intronic
1018916721 6:168136734-168136756 AGGGTTGTAGGGAGTGGGGGTGG + Intergenic
1018990192 6:168668793-168668815 GGGGATGCAGGGTGTGGGGGAGG - Intronic
1018990222 6:168668876-168668898 GGGGATGTGGGGTGTGGGGGAGG - Intronic
1018990237 6:168668915-168668937 GGGGACGCAGGGTGTGGGGGAGG - Intronic
1018990291 6:168669055-168669077 GGGGACGCAGGGTGTGGGGGAGG - Intronic
1018990317 6:168669117-168669139 GGGGACGTAGGGTGTGGGGGAGG - Intronic
1018990369 6:168669224-168669246 GGGGGCGTGGGGTGTGGGGGAGG - Intronic
1019126049 6:169840601-169840623 GGTGTAGTGTGGAGTGGGCGTGG - Intergenic
1019164211 6:170087807-170087829 GGAGGAGCATGGTGTGGGGGGGG + Intergenic
1019529223 7:1495289-1495311 GGCTTAGTGGGGTGTGGGGCAGG + Intronic
1020246636 7:6434639-6434661 GGTGTCTTTGGGTGTGTGGGGGG - Intronic
1020968333 7:14901607-14901629 GGGGCAGTGGGGGGTGGGGGGGG - Intronic
1021253262 7:18358037-18358059 GGTGTAGCTGGGTGTGGTGGTGG + Intronic
1021967009 7:25929659-25929681 GGGGTGGTTGGGCGTGGGGGAGG + Intergenic
1022307129 7:29157252-29157274 GGTGTAGCAGGGTGGGGGAGGGG - Intronic
1022405813 7:30088905-30088927 GGTGTTGTAGGGTGGGGTGGGGG + Intronic
1022747542 7:33188122-33188144 GGTGGGGTAGGGTGGGGGGAGGG + Intronic
1023047253 7:36220947-36220969 GGTGTGGTGGTGTGTGGTGGTGG - Intronic
1023838628 7:44082800-44082822 GGTGTTGGAGGGGGTGGAGGAGG + Intergenic
1025258343 7:57400112-57400134 AGTGTGGGAGGGTGTGGGGATGG + Intergenic
1025260300 7:57413854-57413876 GGAGTGGAAGGGTGTGGTGGGGG + Intergenic
1026769629 7:73187167-73187189 GGGGGAGGAGGGGGTGGGGGTGG + Intergenic
1026955420 7:74373554-74373576 GGTGGAGTTGGGGGTGGGGGTGG + Intronic
1027010498 7:74740553-74740575 GGGGGAGGAGGGGGTGGGGGTGG + Intronic
1027077544 7:75205491-75205513 GGGGGAGGAGGGGGTGGGGGTGG - Intergenic
1027318613 7:76998872-76998894 GGTGGAGTTGGGTGTGTGTGGGG + Intergenic
1028283906 7:88970353-88970375 AGTGTAGAGGGTTGTGGGGGTGG - Intronic
1028521203 7:91733171-91733193 GGTGTTGCAGGGGGTGAGGGTGG - Intronic
1028778743 7:94709939-94709961 GTTGTAGCAGGGGGTGGGGAAGG + Intergenic
1029272453 7:99385293-99385315 GGGGAAGTTGGGTGGGGGGGGGG + Intronic
1029695833 7:102212657-102212679 GGTGGGGTGGGGTGTGGGGGTGG - Intronic
1029746058 7:102516476-102516498 GGTGGAGCAGGGTGGGGGGCAGG - Intronic
1029763996 7:102615455-102615477 GGTGGAGCAGGGTGGGGGGCAGG - Intronic
1030708126 7:112716417-112716439 CCTGTTGTAGGGTGTGGGGAGGG - Intergenic
1030933623 7:115556808-115556830 GGTGGTTTAGGGTGTGGGGAGGG - Intergenic
1031171905 7:118302769-118302791 CCTGTGGTGGGGTGTGGGGGAGG - Intergenic
1031873626 7:127113548-127113570 GGTGAAGTAGGTTGGCGGGGTGG + Intronic
1034150254 7:148909796-148909818 GGTGTAGGAGGCTGGGGGAGTGG + Intergenic
1034381696 7:150701675-150701697 GGAGTAATATGGTGGGGGGGGGG - Intergenic
1034412887 7:150950467-150950489 GGTGGAGTAGAGTGTGGGTTGGG - Intronic
1034487849 7:151377336-151377358 GGTGTAGGAGGGGGTGGGCAGGG + Exonic
1034585715 7:152090644-152090666 GGTGGGGTGGGGTGGGGGGGTGG - Intronic
1035436528 7:158863849-158863871 GGTGTTGGAGGGTGTTGGAGGGG + Intronic
1035709885 8:1705181-1705203 GGGCGAGTAGGGAGTGGGGGAGG + Exonic
1036561746 8:9904667-9904689 GGTGGAGGAGGGCATGGGGGTGG - Intergenic
1037632677 8:20672425-20672447 GGTGTGGGTGGGTGTGGAGGAGG - Intergenic
1037674760 8:21043400-21043422 GGTGGTGGAAGGTGTGGGGGAGG - Intergenic
1038336323 8:26648696-26648718 GCTGTCGTGGTGTGTGGGGGAGG - Intronic
1038697971 8:29822990-29823012 AGGGTACTAGGGTCTGGGGGAGG + Intergenic
1038954830 8:32456481-32456503 GATGGAGTAGGGTATGGAGGAGG - Intronic
1039834692 8:41247170-41247192 GGTTTAGGAGGCTGTGGGGCAGG + Intergenic
1040071946 8:43195686-43195708 GGAGGAGGAGGGTGTGGAGGAGG + Intronic
1040540333 8:48347921-48347943 GGTGTTGGTGGGGGTGGGGGTGG - Intergenic
1040617998 8:49059233-49059255 GGTGTGGTGTGGTGTGGGGTTGG + Intronic
1040832251 8:51690318-51690340 ACTGTTGTAGGGTGTGGGGAAGG - Intronic
1041231534 8:55757660-55757682 GGTGGAGGAGTGTGTGGGGCAGG - Intronic
1042151737 8:65794306-65794328 GGTCTTGTGGGGTGTGGTGGTGG - Intronic
1042462366 8:69084633-69084655 GGTCTAGTAGAGAGTGGGTGTGG - Intergenic
1042531347 8:69819328-69819350 TGTGGAGTAGGGGGTGGCGGTGG - Intronic
1042591606 8:70403066-70403088 GGTGAAGCGGGGTGTCGGGGCGG - Intronic
1042616122 8:70651612-70651634 GGTGTGGTAGGGGGTCAGGGAGG - Intronic
1043048028 8:75352238-75352260 AGTGTTGTTGGGGGTGGGGGTGG + Intergenic
1043747037 8:83887436-83887458 GGGGAACTAGGGGGTGGGGGTGG - Intergenic
1044866441 8:96575375-96575397 GGTGGGGTAGGGTGGGGTGGTGG + Intronic
1045002966 8:97894184-97894206 TGTGTGGTGGGGTGTGGGGTGGG - Intronic
1045986155 8:108251766-108251788 GGTTAAGGAGGATGTGGGGGTGG + Intronic
1046297113 8:112234123-112234145 GGTGTACGTGTGTGTGGGGGAGG - Intronic
1047262407 8:123274524-123274546 GGAGTAGCAGGGTCTGGGCGTGG - Intronic
1047778035 8:128089653-128089675 CGCATAGCAGGGTGTGGGGGGGG + Intergenic
1047928450 8:129703184-129703206 GGAGTAGGAGGGCGTGGGGTGGG - Intergenic
1048201919 8:132381813-132381835 GGTGTACAAGGTTGTGGGAGAGG - Intronic
1048859007 8:138709630-138709652 CCTGTAGTAGGGTGGGGGGAGGG + Intronic
1049419601 8:142510922-142510944 GGAGGAGGAGGGTCTGGGGGCGG - Exonic
1049426316 8:142539526-142539548 GGTGTGGCTGGGTGTGGGTGGGG - Intronic
1049541603 8:143211488-143211510 GGGGTAGACAGGTGTGGGGGAGG + Intergenic
1049543268 8:143218150-143218172 GGTGTTGGGTGGTGTGGGGGTGG - Intergenic
1049582307 8:143418277-143418299 GGGGTTGGAGGGTGTGTGGGAGG - Intergenic
1050250376 9:3737440-3737462 GGAGTAGTGACGTGTGGGGGTGG - Intergenic
1050530852 9:6588110-6588132 GGTTTAAAAGGGGGTGGGGGTGG + Intronic
1050561099 9:6834964-6834986 GATGCAGGATGGTGTGGGGGAGG - Intronic
1051924172 9:22303641-22303663 TGTGTGACAGGGTGTGGGGGAGG + Intergenic
1052369843 9:27651576-27651598 GGTGTTGTGGGGTGAGGGGAAGG + Intergenic
1052869300 9:33487589-33487611 GGCATGGTAGGGGGTGGGGGAGG + Intergenic
1053047899 9:34935721-34935743 AGTGTATTTGTGTGTGGGGGGGG + Intergenic
1053428900 9:38028901-38028923 GGGGTGGTAGGGTGAGGGTGAGG + Intronic
1054490132 9:65767682-65767704 CGTGGGGTGGGGTGTGGGGGGGG + Intergenic
1055030470 9:71768314-71768336 GGTGGAGCGGGGTGGGGGGGCGG + Intronic
1055923730 9:81488901-81488923 GGTGTGGTAGGGGGTGGGGGTGG - Intergenic
1056742259 9:89267618-89267640 GGTTTTGTGGGGGGTGGGGGGGG + Intergenic
1057140906 9:92726300-92726322 GGTGTGTTGGGGTGTGGAGGGGG + Intronic
1057263977 9:93601933-93601955 GGGGTGGTAGGGTGGGGTGGGGG + Intronic
1057308215 9:93924805-93924827 GGTGGAGTAGGGGGAGGGCGGGG + Intergenic
1057593626 9:96395410-96395432 TGTGTAATAGGATTTGGGGGTGG - Intronic
1058491072 9:105500262-105500284 GTGGTAGTAAGGTGTGTGGGAGG + Intronic
1058917995 9:109586111-109586133 GGAATGGTAGGGCGTGGGGGTGG - Intergenic
1059149861 9:111939612-111939634 GTTTTAGTAGGGTGAGGGTGGGG - Intergenic
1059457649 9:114409814-114409836 GGTGGAGTGGGGTGAGGGGAAGG - Intronic
1059529988 9:115026852-115026874 GGGGTGGGAGGGGGTGGGGGTGG + Intronic
1059657614 9:116370252-116370274 TGTGTGGTAGGGGGTGGAGGTGG - Intronic
1060557414 9:124515528-124515550 GGTGGGGTGGGGTGGGGGGGAGG + Intergenic
1060565940 9:124591780-124591802 TGTGTGGTGGGGGGTGGGGGAGG - Intronic
1060826014 9:126688521-126688543 GGGGCAGTAGGGGTTGGGGGAGG + Intronic
1060965607 9:127710869-127710891 GGAGTAGCAGGTTGTCGGGGCGG - Intronic
1061005680 9:127927527-127927549 GGGGTTGTAGGGCATGGGGGTGG - Intronic
1061201471 9:129140789-129140811 GGTGGGGTAGGGTGGGGAGGTGG + Intronic
1061417394 9:130454539-130454561 GGTGGAAGAGGGCGTGGGGGAGG - Intronic
1061839198 9:133347892-133347914 GGTGTGGTGGGGGGTGGGGATGG - Intronic
1061896623 9:133651804-133651826 GTGGTGGCAGGGTGTGGGGGCGG - Intronic
1062286375 9:135774839-135774861 GGTGTGGAAGGGGGTGGCGGTGG - Intronic
1203383694 Un_KI270435v1:90920-90942 AGTGTAGTCCGGTGTGGGGAGGG + Intergenic
1203683385 Un_KI270757v1:9203-9225 AGTGTAGTCCGGTGTGGGGAGGG + Intergenic
1185464337 X:346036-346058 GGTGGAGGTGGGGGTGGGGGTGG + Intronic
1185736550 X:2500657-2500679 GGTGTGGCCGGGGGTGGGGGGGG - Intronic
1185867905 X:3639388-3639410 GGGGTAGAGGGGTGGGGGGGTGG + Intronic
1186008460 X:5102247-5102269 AGGGTAGTAGGGGGTGGAGGGGG - Intergenic
1186116976 X:6314485-6314507 GTTGTGGTGGGGTATGGGGGTGG - Intergenic
1186281314 X:7995808-7995830 GGGCTACTAGGGTGTGGGGCAGG + Intergenic
1186363744 X:8870380-8870402 GGTGGAGGAGGATGTGGAGGAGG + Intergenic
1186943163 X:14534769-14534791 GTTGTAGTAGAATGTGAGGGTGG + Intronic
1187472977 X:19585909-19585931 TTTGCAGGAGGGTGTGGGGGAGG - Intronic
1187940509 X:24376183-24376205 TGTGTGGTGGGGAGTGGGGGGGG + Intergenic
1189555790 X:42144041-42144063 GGGGTTGAAGGCTGTGGGGGAGG + Intergenic
1189612308 X:42750363-42750385 AGGGTAGTTGGGAGTGGGGGTGG + Intergenic
1190641048 X:52482884-52482906 GGAGGGGAAGGGTGTGGGGGAGG - Intergenic
1190646624 X:52529981-52530003 GGAGGGGAAGGGTGTGGGGGAGG + Intergenic
1191110555 X:56800435-56800457 TGTGTGGGATGGTGTGGGGGTGG + Intergenic
1191709253 X:64132026-64132048 ACTGTTGTAGGGTGTGGGAGGGG - Intergenic
1192220368 X:69193761-69193783 GGTGTAGAGGAGTGTGGGGATGG - Intergenic
1192980442 X:76334147-76334169 AGTGTAGGAGGGGGTTGGGGAGG + Intergenic
1193896655 X:87122169-87122191 ACTGTAGTGGGGTGTGGGGAGGG + Intergenic
1194117770 X:89923756-89923778 GGTTTGGTAGGGAGTGGGGTAGG + Intergenic
1194225122 X:91246837-91246859 AGTGTAGTGGGGTGGGGGTGGGG - Intergenic
1194793757 X:98184200-98184222 GGTGGGGTGGGGGGTGGGGGTGG - Intergenic
1195009308 X:100719671-100719693 GGTGGGGCAGGGGGTGGGGGTGG + Intronic
1195174927 X:102305881-102305903 GGTGCGGGAGGGTGGGGGGGTGG + Intergenic
1195183938 X:102381212-102381234 GGTGCGGGAGGGTGGGGGGGTGG - Intronic
1195558244 X:106251965-106251987 GGTGTTGCAGGGTTTGGAGGAGG - Intergenic
1195675103 X:107502018-107502040 GGTTAAGGAGGGTGTGGGTGGGG + Intergenic
1196866799 X:120077833-120077855 GGTGTAGTAGGGTGTGGGGGAGG + Intergenic
1196866810 X:120077855-120077877 GGGGGAGTAGGGCGTGGGAGGGG + Intergenic
1196876289 X:120158426-120158448 GGGGGAGTAGGGCGTGGGAGGGG - Intergenic
1196876300 X:120158448-120158470 GGTGTAGTAGGGTGTGGGGGAGG - Intergenic
1197882997 X:131188931-131188953 TTTGTGGTGGGGTGTGGGGGGGG + Intergenic
1197942332 X:131803114-131803136 TGTTTAGTGGGGGGTGGGGGGGG - Intergenic
1199097536 X:143759730-143759752 GGTGCAGTAGGGACTGGGAGAGG + Intergenic
1199894474 X:152117576-152117598 GATGGGGTAGGGTGTGGGGATGG + Intergenic
1199982095 X:152926713-152926735 GGGGTAGCGGGTTGTGGGGGAGG + Intronic
1200470551 Y:3580909-3580931 GGTTTGGTAGGGAGTGGGGTAGG + Intergenic
1200561588 Y:4710144-4710166 AGTGTAGTGGGGTGGGGGTGGGG - Intergenic
1201109731 Y:10790435-10790457 GGTGGAGTGGGGTGGAGGGGGGG - Intergenic
1202038164 Y:20656158-20656180 GGTGTGGCAGGGGGTGGGAGTGG - Intergenic