ID: 1196876301

View in Genome Browser
Species Human (GRCh38)
Location X:120158451-120158473
Sequence AGTGGTGTAGTAGGGTGTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 357
Summary {0: 2, 1: 0, 2: 2, 3: 27, 4: 326}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196876301_1196876320 23 Left 1196876301 X:120158451-120158473 CCCCCACACCCTACTACACCACT 0: 2
1: 0
2: 2
3: 27
4: 326
Right 1196876320 X:120158497-120158519 AACGCGTGCTCTCCCTCATCCGG 0: 2
1: 0
2: 0
3: 0
4: 47
1196876301_1196876321 24 Left 1196876301 X:120158451-120158473 CCCCCACACCCTACTACACCACT 0: 2
1: 0
2: 2
3: 27
4: 326
Right 1196876321 X:120158498-120158520 ACGCGTGCTCTCCCTCATCCGGG 0: 2
1: 0
2: 0
3: 4
4: 84
1196876301_1196876322 29 Left 1196876301 X:120158451-120158473 CCCCCACACCCTACTACACCACT 0: 2
1: 0
2: 2
3: 27
4: 326
Right 1196876322 X:120158503-120158525 TGCTCTCCCTCATCCGGGCAAGG 0: 2
1: 0
2: 0
3: 11
4: 118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196876301 Original CRISPR AGTGGTGTAGTAGGGTGTGG GGG (reversed) Intergenic