ID: 1196876301

View in Genome Browser
Species Human (GRCh38)
Location X:120158451-120158473
Sequence AGTGGTGTAGTAGGGTGTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 357
Summary {0: 2, 1: 0, 2: 2, 3: 27, 4: 326}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196876301_1196876321 24 Left 1196876301 X:120158451-120158473 CCCCCACACCCTACTACACCACT 0: 2
1: 0
2: 2
3: 27
4: 326
Right 1196876321 X:120158498-120158520 ACGCGTGCTCTCCCTCATCCGGG 0: 2
1: 0
2: 0
3: 4
4: 84
1196876301_1196876322 29 Left 1196876301 X:120158451-120158473 CCCCCACACCCTACTACACCACT 0: 2
1: 0
2: 2
3: 27
4: 326
Right 1196876322 X:120158503-120158525 TGCTCTCCCTCATCCGGGCAAGG 0: 2
1: 0
2: 0
3: 11
4: 118
1196876301_1196876320 23 Left 1196876301 X:120158451-120158473 CCCCCACACCCTACTACACCACT 0: 2
1: 0
2: 2
3: 27
4: 326
Right 1196876320 X:120158497-120158519 AACGCGTGCTCTCCCTCATCCGG 0: 2
1: 0
2: 0
3: 0
4: 47

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196876301 Original CRISPR AGTGGTGTAGTAGGGTGTGG GGG (reversed) Intergenic
902838306 1:19060343-19060365 TGTGGTGGAGTAGGGGGTGGCGG - Intergenic
902838364 1:19060509-19060531 TGTGGTGGAGTAGGGTGTGGGGG - Intergenic
902838377 1:19060550-19060572 TGTGGTGGAGTGGGGGGTGGGGG - Intergenic
902838395 1:19060592-19060614 TGTGGTGGAGTGGGGGGTGGGGG - Intergenic
904375982 1:30082828-30082850 GGTGGTGTGGTGGGGTGGGGTGG - Intergenic
904641821 1:31937476-31937498 AGGAGTGTGGTAGGGTGTGCCGG - Intronic
904973801 1:34440678-34440700 TGGGGTGAAGTAGGGTGTGGGGG + Intergenic
904974089 1:34442695-34442717 AGTGGTGCAGGAGGGTGGGGAGG - Intergenic
905800597 1:40839895-40839917 AGTGAAGAAGTGGGGTGTGGAGG - Exonic
907203923 1:52752355-52752377 AGGGGTGGGGTAGGGTGTGCTGG - Intronic
907807682 1:57837799-57837821 AGTGGTGGAGATGGGGGTGGAGG - Intronic
907858324 1:58325983-58326005 AGGGGTGGAGCAGGGTGGGGTGG - Intronic
910465750 1:87497559-87497581 AGTGGGGAAGTTGGGGGTGGTGG - Intergenic
911508547 1:98784163-98784185 ACTGGTGTGTTAGGCTGTGGGGG - Intergenic
912813118 1:112808901-112808923 AGTGGGGGTCTAGGGTGTGGTGG + Intergenic
913111385 1:115660306-115660328 AGTGCTGTAGTGTGGTGTGAAGG + Intronic
915030977 1:152880301-152880323 AGTGGTGAATTTGGGTGTGCCGG - Intronic
916089168 1:161293790-161293812 AGTTGCGTAGCTGGGTGTGGTGG + Intergenic
916537898 1:165721840-165721862 AGTGGGGTAGGTGGGCGTGGTGG + Intergenic
916676060 1:167065294-167065316 AGTGGTGGAGGTGGGAGTGGTGG + Intronic
916692967 1:167208814-167208836 TGTTGAGAAGTAGGGTGTGGTGG - Intergenic
917841484 1:178983464-178983486 AGTGTTGGAGTAGGGCCTGGTGG + Intergenic
918672652 1:187239145-187239167 AGTGGTGGGGGAGGGTGTGGTGG + Intergenic
918856864 1:189766825-189766847 ACTGATGTGGTAGAGTGTGGAGG - Intergenic
918857889 1:189782014-189782036 AGTGGTGGAGTAGGGCATAGTGG - Intergenic
918907007 1:190509648-190509670 AGATGTGTAGTCAGGTGTGGTGG + Intergenic
919733391 1:200928826-200928848 AGTGGTGTAGAGGGGTGGGGAGG + Intergenic
919981766 1:202646317-202646339 CCTGGTGCAGTGGGGTGTGGAGG - Intronic
920390616 1:205598204-205598226 AGAGGTGGGGTAGGGAGTGGTGG - Intronic
920692269 1:208155795-208155817 AGGGGTGTGGTGGGGTGTGCAGG + Intronic
921006629 1:211100231-211100253 AGTGGTGGAGAAGGCGGTGGAGG - Intronic
922146849 1:222954944-222954966 GGTGGTGGGGTGGGGTGTGGGGG + Intronic
922979576 1:229814213-229814235 GGTTGTGTGGTAGGGTGGGGAGG + Intergenic
923279168 1:232425635-232425657 CGTGCTGTGGTAGGGTGGGGTGG + Exonic
923552285 1:234973523-234973545 AGAGGTGGAGTGGGGTGAGGTGG + Intergenic
923962762 1:239103434-239103456 AGTGTTGTTGTAGGGTTTGAGGG - Intergenic
924603583 1:245513139-245513161 GGGGGTGGAGGAGGGTGTGGAGG - Intronic
1063937010 10:11088650-11088672 GGTGGTTTTGTTGGGTGTGGTGG + Intronic
1064993836 10:21279406-21279428 AGTGCTTTAGTAGGCTGAGGCGG - Intergenic
1065505093 10:26422400-26422422 AGTGTTGTAAAAGGGTATGGAGG - Intergenic
1065589698 10:27252041-27252063 AGTGGTGGGGTAGGGTGGGGTGG + Intergenic
1067101117 10:43335404-43335426 CGTGGTGTAGCCGGGCGTGGTGG + Intergenic
1071080791 10:81807451-81807473 AATGTGGTGGTAGGGTGTGGGGG - Intergenic
1075318269 10:121469298-121469320 AGTGGGGGAGCGGGGTGTGGGGG - Intergenic
1075562199 10:123476199-123476221 AGTGTTGTAGGTGGGTCTGGTGG + Intergenic
1076006664 10:126953273-126953295 AGTGTTGTGGTGTGGTGTGGTGG + Intronic
1076291668 10:129350126-129350148 GGTGGGGTAGTGGGGGGTGGAGG - Intergenic
1076676470 10:132149784-132149806 AGGGGTGAGGTAGGGTGGGGTGG - Intronic
1077780279 11:5320329-5320351 AGTAGTGTAGTAGTATTTGGTGG + Intronic
1078763852 11:14274795-14274817 ACTGGACTAGTCGGGTGTGGTGG + Intergenic
1078849459 11:15150715-15150737 AGTGGTCTGACAGGGTGTGGTGG + Intronic
1079687352 11:23376555-23376577 GGAAGTGTAGTGGGGTGTGGAGG + Intergenic
1079972732 11:27056541-27056563 AATGGTGCAGCTGGGTGTGGTGG - Intronic
1080696802 11:34609742-34609764 AGTGTGGTAGTAGGGACTGGGGG + Intergenic
1081927490 11:46842994-46843016 AGTAAGGTAGCAGGGTGTGGTGG + Intronic
1082045715 11:47724601-47724623 GGTGGTGGAGGAGGGGGTGGAGG + Exonic
1083309197 11:61775862-61775884 GGGTGTGAAGTAGGGTGTGGGGG + Intronic
1083421341 11:62554907-62554929 ATGGGTGGAGTAGGGTATGGTGG - Intronic
1083955184 11:65978929-65978951 GCTGGTGGGGTAGGGTGTGGTGG + Intronic
1084729885 11:71066133-71066155 AGTGGGGAAGTTGGGTGGGGGGG + Intronic
1086211658 11:84328090-84328112 GGTAGTGTAGGAGAGTGTGGAGG + Intronic
1086367037 11:86117609-86117631 AGGGGTCTAGTAGGCGGTGGAGG + Intergenic
1087837592 11:102890450-102890472 AAGGGTGTAGCCGGGTGTGGTGG - Intergenic
1090745381 11:129701001-129701023 TGGGGTGCAGTGGGGTGTGGAGG + Intergenic
1091342771 11:134830942-134830964 AGTGGTGAAGTTGGGTGTGGTGG - Intergenic
1093011652 12:14113288-14113310 AGTGCTGGAGTGGGGTGGGGTGG + Intergenic
1093542710 12:20305879-20305901 AGTAGTTGAGCAGGGTGTGGTGG - Intergenic
1096386575 12:51198494-51198516 GGGGGTGTAGTAGAGGGTGGGGG + Intronic
1096562459 12:52446493-52446515 ACTGATGGAGTAGGCTGTGGAGG + Intergenic
1096848533 12:54420834-54420856 AGTGGAGTAGCAGAGTGAGGGGG - Intergenic
1097836572 12:64279205-64279227 AATGGTGGAGTTGGGTGTGGAGG - Intronic
1097876449 12:64648289-64648311 AGTGGTGTGGCAGCATGTGGAGG + Intronic
1098981174 12:76957583-76957605 AGTGCTGGAGAAGGGTGAGGTGG - Intergenic
1101932826 12:109028762-109028784 TGTGTGGTAGTCGGGTGTGGTGG - Intronic
1102792290 12:115657655-115657677 TGTGGGGTAACAGGGTGTGGGGG - Intergenic
1103993105 12:124812242-124812264 TATGCTGGAGTAGGGTGTGGTGG - Intronic
1104066608 12:125311999-125312021 AGTGCAGTAATAGGGAGTGGTGG + Intronic
1104084235 12:125459523-125459545 AGGGTAGTAGTAGGGTGTGGTGG + Intronic
1104371295 12:128225989-128226011 GGTGGTGTAATAGGCAGTGGTGG - Intergenic
1104419430 12:128622725-128622747 AGGCGTGTCGTAGGATGTGGGGG + Intronic
1104575461 12:129962531-129962553 AGTGGAGTAGTAGGACTTGGAGG + Intergenic
1104932927 12:132349459-132349481 GGTGGTGGAGTAGGTAGTGGTGG - Intergenic
1105452787 13:20515481-20515503 AGTTGAGTAGAAGGGTGAGGGGG + Intronic
1107172633 13:37360920-37360942 AGTGATGCAGTAGGGTTTTGGGG - Intergenic
1107844378 13:44496393-44496415 AGTGGGGTGGCCGGGTGTGGTGG + Intronic
1110449802 13:75628864-75628886 AGTGGTGGGGTAGGGTGGAGAGG - Intronic
1112817704 13:103292346-103292368 GGTGTTGTTGCAGGGTGTGGGGG - Intergenic
1113574506 13:111384925-111384947 AGTGGTGTGGCAGGATGTTGGGG + Intergenic
1113966196 13:114155253-114155275 AGGGGAGGAGTGGGGTGTGGAGG + Intergenic
1114948089 14:27712233-27712255 AGTAATGTAGTATGGTGAGGAGG + Intergenic
1116851050 14:49909789-49909811 TGTGGTCTAGCTGGGTGTGGTGG - Intergenic
1117026455 14:51625268-51625290 AGTGGTGTTGGAGGAGGTGGTGG + Intronic
1117312386 14:54540973-54540995 CGAGATGTAGTATGGTGTGGAGG + Intergenic
1117706522 14:58475375-58475397 GGTGGTGGGGTAGGGGGTGGGGG - Intronic
1119944504 14:78678434-78678456 ACTGGAGTAGCTGGGTGTGGTGG - Intronic
1121404772 14:93712981-93713003 AGTGGGGATGCAGGGTGTGGGGG + Intergenic
1121608408 14:95258436-95258458 TGTGGTGTGGTTGTGTGTGGAGG + Intronic
1121758119 14:96420207-96420229 AGTGGTATGGTTGGATGTGGTGG + Intronic
1121760060 14:96437058-96437080 AGAAGGGTAGTAGGGGGTGGGGG + Intronic
1121898133 14:97667897-97667919 AGTGGAGTAGCAGGGGGTAGAGG - Intergenic
1122149034 14:99714471-99714493 TTTGGTGTAGCTGGGTGTGGCGG + Intronic
1122760300 14:104019968-104019990 GGTGGTGCAGTAGGGTCAGGTGG + Intronic
1124133268 15:27009251-27009273 AGTGTTGTAATAGGGTGGGTTGG + Intronic
1124421779 15:29529223-29529245 AGGGGTGTGTGAGGGTGTGGAGG + Intronic
1124421785 15:29529243-29529265 AGGGGTGTGTGAGGGTGTGGAGG + Intronic
1124467078 15:29949356-29949378 AGTGGTGAAGATGGTTGTGGTGG - Intronic
1124467200 15:29949794-29949816 AGTGGTGAAGATGGTTGTGGTGG - Intronic
1125680744 15:41528717-41528739 AGTGGTGTAGCAGGAAGTGAAGG + Intronic
1127683990 15:61323839-61323861 AGTGGTGTGGTTGGGTGAGATGG + Intergenic
1128091645 15:64923145-64923167 ATTGGTGTGTTAGGTTGTGGGGG - Intronic
1131007983 15:88994088-88994110 GGTGGTGTAGGGGGGTGTGGGGG - Intergenic
1131630731 15:94174324-94174346 AATGGTGGGGTATGGTGTGGTGG - Intergenic
1132693150 16:1190652-1190674 GGTGGTATAGCAGGGTCTGGGGG - Intronic
1133697556 16:8279460-8279482 AGTGGAGGAGTAGGGTGGGTAGG - Intergenic
1133914118 16:10093381-10093403 AGTGGTCTAGTAAGATGGGGAGG - Intronic
1133986034 16:10668881-10668903 CGTGCTGTAATAGGGAGTGGTGG + Intronic
1135562470 16:23487294-23487316 AGTGGGGTAGGGGGATGTGGGGG + Intronic
1136254591 16:29029590-29029612 GGTGGTGCAGTGGGTTGTGGAGG + Intergenic
1136267787 16:29131281-29131303 AGTGGGGTGGGAGGATGTGGTGG - Intergenic
1137041801 16:35620059-35620081 TGTGGTGGAGCAGGGTGGGGGGG + Intergenic
1137616669 16:49852599-49852621 GGTGGTGTGGTATGGTGTGGTGG - Intronic
1137716050 16:50598903-50598925 AGTGGTGTGGTGGGCAGTGGTGG + Intronic
1138503366 16:57462886-57462908 GGGGGTGTAGTGGGGTGGGGTGG + Intronic
1143196430 17:5079375-5079397 AGTTGGGTAGTTGGGTGTGGTGG + Intronic
1144613793 17:16750171-16750193 AGTTGTGTAATAGGGTCTGTGGG + Intronic
1144898920 17:18565495-18565517 AGTTGTGTAATAGGGTCTGTGGG - Intergenic
1144948780 17:18983017-18983039 AGTGGCGCAGTGGGCTGTGGGGG + Intronic
1145133456 17:20380224-20380246 AGTTGTGTAATAGGGTCTGTGGG + Intergenic
1146289752 17:31598741-31598763 CGTGGAGTCGCAGGGTGTGGGGG + Intergenic
1146330124 17:31920025-31920047 AGTGGGGTATGAGTGTGTGGAGG - Intergenic
1146418032 17:32655268-32655290 AGTGCTGTTGTAGGCAGTGGGGG + Intronic
1146926740 17:36750768-36750790 AGTGGTGTAGGAGGGTCTGTAGG + Intergenic
1147458123 17:40551438-40551460 AGGGTTGCAGGAGGGTGTGGGGG - Intergenic
1148940507 17:51205985-51206007 AGTAGTGTAGTAGGGCATTGTGG - Intronic
1149062664 17:52441739-52441761 AGTTGTGTAGAAGGGTGATGTGG - Intergenic
1149578930 17:57734411-57734433 AGTGGAGTAGTGGGGGGTGGAGG - Intergenic
1149628098 17:58094401-58094423 GGTGGTGCAATAGGGTGTGAGGG - Exonic
1149987083 17:61355380-61355402 AGTTGGGTGGTAGGGGGTGGAGG - Intronic
1150089753 17:62313133-62313155 ATTGGTGTGGCTGGGTGTGGTGG + Intergenic
1150429752 17:65105638-65105660 AGTGGTGGGGTGGGGTGGGGAGG + Intergenic
1153387166 18:4510909-4510931 GGTGGTGTGGTGGTGTGTGGTGG + Intergenic
1153387182 18:4510986-4511008 GGTGGTGTGGTGGTGTGTGGTGG + Intergenic
1153929188 18:9863836-9863858 AGTCGTGTGGGAGGGGGTGGTGG - Intergenic
1155166974 18:23239572-23239594 AGTGGGGCAGTTGGGGGTGGGGG + Intronic
1156354500 18:36329586-36329608 AGTGATGGGGTAGGGTGGGGTGG + Intronic
1156970038 18:43143153-43143175 AGTAGTGTAGCTGGGGGTGGTGG + Intergenic
1157199945 18:45651596-45651618 AGTGCAGGAGCAGGGTGTGGAGG + Intronic
1157200159 18:45653212-45653234 AGTGGTGGGGAATGGTGTGGAGG - Intronic
1159090887 18:63847736-63847758 AGTGGTGAATTAGGTTTTGGAGG + Intergenic
1159130025 18:64270844-64270866 AGTGGGGTGGAAGGGTGAGGTGG + Intergenic
1161004285 19:1926717-1926739 AGGGGGGTTGTGGGGTGTGGTGG + Intergenic
1162145968 19:8612072-8612094 AGGGCTGGAGTAGGGGGTGGAGG + Intergenic
1162893256 19:13748949-13748971 AGTGGTGTAGTGAGGTGGTGAGG - Intronic
1163086397 19:14983393-14983415 TGTGGGGTAGCTGGGTGTGGTGG + Intronic
1163166045 19:15499002-15499024 CGGGGTGCAGTAGGGGGTGGGGG + Intergenic
1163240753 19:16062114-16062136 TGTGGTGTGGTGTGGTGTGGTGG - Intergenic
1164478720 19:28595008-28595030 AGTGATGTGTTAGAGTGTGGGGG - Intergenic
1164576355 19:29407532-29407554 AATGGTGTTGCAGGGGGTGGAGG - Intergenic
1164809429 19:31144436-31144458 AGTAGTGTAGAAGGGTGTTTTGG + Intergenic
1165341571 19:35216030-35216052 AGTGATACAGCAGGGTGTGGTGG + Intergenic
1166830086 19:45634094-45634116 GGTGTTTTAGTTGGGTGTGGTGG - Intronic
1167667971 19:50833633-50833655 TGTGGTGGTGTAGGGTGGGGTGG + Intronic
1167730335 19:51249581-51249603 ACTGTTGTAATAGGGAGTGGAGG + Intronic
925183375 2:1831107-1831129 AGTGGGGTTGCAGGGTGTGGTGG - Intronic
926670606 2:15573948-15573970 GGGGGTGGAGTAGGGTGTAGAGG + Intergenic
931454572 2:62398549-62398571 AGTGGGGAAGGAGGATGTGGAGG - Intergenic
932780885 2:74557585-74557607 AGTGGTTGGGTTGGGTGTGGTGG + Intergenic
933978211 2:87528887-87528909 TGTGGTGTGGTATGGTGTGCGGG + Intergenic
936315623 2:111421914-111421936 TGTGGTGTGGTATGGTGTGCGGG - Intergenic
936980547 2:118261388-118261410 AGTGCTGTAGCATTGTGTGGGGG + Intergenic
937316077 2:120932898-120932920 AGTGCTGTGGTGCGGTGTGGTGG + Intronic
937736713 2:125299366-125299388 AGGGGGGTTGTAGGGGGTGGTGG + Intergenic
939050608 2:137302611-137302633 AGTGGGGTAGTAGCTGGTGGAGG + Intronic
940808378 2:158213980-158214002 AGTGGTGGGGTAGGGGGAGGGGG + Intronic
942176651 2:173341141-173341163 AGTAAAGTAGTTGGGTGTGGTGG + Intergenic
942802507 2:179891969-179891991 AGTGGGATGGTAGGGGGTGGCGG - Intergenic
944153893 2:196591634-196591656 AGAGGTGGGGTAGGGTGGGGTGG - Intronic
944599650 2:201290371-201290393 AGTGGTGGGGTAGGGTGGGGTGG + Intronic
944822095 2:203441244-203441266 AGTGGGGGAGGAGGGGGTGGTGG + Exonic
945222945 2:207503360-207503382 CGAGGTCTGGTAGGGTGTGGTGG - Intergenic
947092794 2:226531616-226531638 AGTGGGGTTGTGGGGGGTGGGGG - Intergenic
947538371 2:230956012-230956034 ACTGGTGTAGTTGGGCATGGTGG - Intronic
948420286 2:237855504-237855526 AGTTGTGTAGTGGGATTTGGTGG + Intergenic
948720873 2:239899205-239899227 AGGGGTGTGGAGGGGTGTGGTGG + Intronic
948720921 2:239899371-239899393 AGGGGTGTGGAGGGGTGTGGTGG + Intronic
948776099 2:240289846-240289868 GGTGCTGCAGTCGGGTGTGGGGG + Intergenic
949022450 2:241749177-241749199 GGTGGTGTTGGAGGGTCTGGCGG - Intronic
1170798537 20:19571045-19571067 TGTGGTGTGGTGTGGTGTGGTGG + Intronic
1170850376 20:19998890-19998912 AGAGGTGGAGGAGGGTGTGTTGG - Intronic
1173360844 20:42343149-42343171 TGTGGTCTAGGAGAGTGTGGGGG - Intronic
1173517214 20:43673347-43673369 AGAGGTGAGGTCGGGTGTGGTGG + Intronic
1173617670 20:44413636-44413658 AGGGATGGAGTAGGGGGTGGGGG - Intronic
1174275051 20:49397659-49397681 AGAGGAGTAGGAGGGTGAGGTGG + Intronic
1175346999 20:58286967-58286989 AGAGGTGTGGTTGGGTGTTGTGG - Intergenic
1178920262 21:36734126-36734148 CGTGGTGTGGTGTGGTGTGGTGG - Intronic
1179901189 21:44395670-44395692 AGGGGTGTGGAGGGGTGTGGAGG + Intronic
1179901214 21:44395748-44395770 AGGGGTGTGGAGGGGTGTGGAGG + Intronic
1179901239 21:44395826-44395848 AGGGGTGTGGAGGGGTGTGGAGG + Intronic
1179901275 21:44395942-44395964 AGGGGTGTGGAGGGGTGTGGAGG + Intronic
1179901363 21:44396222-44396244 AGGGGTGTGGAGGGGTGTGGAGG + Intronic
1179901374 21:44396252-44396274 AGGGGTGTGGAGGGGTGTGGAGG + Intronic
1179901409 21:44396360-44396382 AGGGGTGTGGAGGGGTGTGGAGG + Intronic
1179901413 21:44396370-44396392 AGGGGTGTGGAGGGGTGTGGAGG + Intronic
1179901437 21:44396449-44396471 AGGGGTGTGGAGGGGTGTGGAGG + Intronic
1179901441 21:44396459-44396481 AGGGGTGTGGAGGGGTGTGGAGG + Intronic
1179901475 21:44396583-44396605 AGGGGTGTAGAGGGGTGTAGAGG + Intronic
1179901478 21:44396593-44396615 AGGGGTGTAGAGGGTTGTGGAGG + Intronic
1179901495 21:44396642-44396664 AGGGGTGTGGAGGGGTGTGGAGG + Intronic
1179901512 21:44396691-44396713 AGGGGTGTGGAGGGGTGTGGAGG + Intronic
1179901532 21:44396750-44396772 AGGGGTGTGGAGGGGTGTGGAGG + Intronic
1179901536 21:44396760-44396782 AGGGGTGTGGAGGGGTGTGGAGG + Intronic
1179901553 21:44396809-44396831 AGGGGTGTGGAGGGGTGTGGAGG + Intronic
1179901584 21:44396898-44396920 AGGGGTGTGGAGGGGTGTGGAGG + Intronic
1179901590 21:44396908-44396930 AGGGGTGTGGAGGGGTGTGGGGG + Intronic
1180033571 21:45229556-45229578 AGTGGTGTGCTAGGGCATGGTGG + Intergenic
1184045381 22:41969688-41969710 AGGGGGGTGGAAGGGTGTGGGGG + Intergenic
1184452635 22:44592021-44592043 ATTGGTGGAGTTGGGAGTGGGGG - Intergenic
1184926827 22:47647820-47647842 AGTGTTGTATGAGTGTGTGGAGG - Intergenic
949711473 3:6875747-6875769 AGGGGTGAAGTAGGGTGGGGAGG + Intronic
949928998 3:9063838-9063860 AGTCCTTTAGTAGGGTGTGGTGG - Intronic
950376894 3:12579728-12579750 AGGTGTGTAGAAGGATGTGGTGG + Intronic
950427608 3:12932918-12932940 AGTGGTGTAGGTTGGTGGGGAGG - Intronic
950511595 3:13431685-13431707 GGGAGTGTAGCAGGGTGTGGTGG + Intergenic
951899311 3:27641316-27641338 AGAGGTGGAAGAGGGTGTGGGGG + Intergenic
952503793 3:33989250-33989272 AGTGGTGTGTTGGGCTGTGGGGG + Intergenic
952568697 3:34687059-34687081 AATTTTGTAGTTGGGTGTGGTGG + Intergenic
953164010 3:40448001-40448023 AGTGGTGTGGTGGGGGGAGGTGG + Intergenic
953538006 3:43790466-43790488 AGTGGGGAAGAAGAGTGTGGTGG - Intergenic
953688206 3:45094700-45094722 AGTGGGGGTGTGGGGTGTGGGGG + Intronic
954291527 3:49652510-49652532 CGAGGTGTAGCTGGGTGTGGAGG - Exonic
957007942 3:74971989-74972011 AGTGATGTATGAGGGAGTGGTGG - Intergenic
958452988 3:94296850-94296872 AGTCGTGTGGTAGGGGTTGGGGG - Intergenic
958891352 3:99786706-99786728 AGTGGTGAATTAGAGAGTGGAGG - Intronic
962349360 3:134645218-134645240 GGTGGGGTAGGAGGGTGAGGAGG + Intronic
964064110 3:152559737-152559759 AGTGGGGGAGTCGGGCGTGGTGG - Intergenic
966833415 3:184030621-184030643 ATTAGTGGAGTAGGGGGTGGTGG - Intergenic
968657225 4:1783847-1783869 AGTGGTGCAGCAGGGTTCGGTGG + Intergenic
968802243 4:2750919-2750941 TGTTGAGTACTAGGGTGTGGAGG - Intronic
969012474 4:4077739-4077761 AGTGGTTTGGGAGGCTGTGGTGG - Intergenic
971418349 4:26453775-26453797 AGTGCATTAGTTGGGTGTGGTGG - Intergenic
973135776 4:46704540-46704562 AGTGGTGGGGTTGGGTGGGGTGG + Intergenic
973712843 4:53646276-53646298 AGTGGAGTAATAGGGCATGGTGG + Intronic
975614911 4:76236667-76236689 AGTGGTGGGGTAGGGTGGTGGGG + Intronic
976002495 4:80388166-80388188 AGTGGTGGAGGAGGGGGTGAAGG + Intronic
977401708 4:96541098-96541120 AGTGGTGAGGAAGGGGGTGGGGG - Intergenic
979976289 4:127200341-127200363 AGTGGTGTAGCAGGGTCAAGTGG - Intergenic
981845608 4:149164688-149164710 TGGGGTGTAGAAGGGTGGGGAGG - Intergenic
982147938 4:152417910-152417932 AGGAGGGTAGTAGGGTGGGGTGG + Intronic
983581475 4:169313590-169313612 AGTGGTTTACTAGGGGGTGGAGG - Intergenic
983813853 4:172098337-172098359 AGTGGGGTTGGAGTGTGTGGTGG + Intronic
985606408 5:860477-860499 GGTGGTGGAGGAGGGTGTGCAGG - Intronic
985675425 5:1229071-1229093 AGTGTTGTGGTTGGGGGTGGTGG - Intronic
987039753 5:14051265-14051287 AGTGGTTTAGTTGGGTGAGAGGG + Intergenic
988875074 5:35435598-35435620 AGTGGGGTGGCATGGTGTGGGGG - Intergenic
989100585 5:37819076-37819098 AGTGCTTGAGTAGGCTGTGGAGG + Intronic
989189970 5:38661118-38661140 AGGGGTGGAGCAGGGGGTGGGGG + Intergenic
989785925 5:45329416-45329438 AGTGGTGGTGTAGGGAGTGGGGG + Intronic
989792530 5:45422879-45422901 AGAAGGGTAGTAGGGAGTGGGGG + Intronic
990930639 5:61087006-61087028 AATGGGGTAGAAGAGTGTGGGGG - Intronic
991357265 5:65781967-65781989 AGTGTTGGGGGAGGGTGTGGGGG - Intronic
992170194 5:74093746-74093768 GGTGCTGTTGTAGGGTGTGGGGG - Intergenic
993089156 5:83402084-83402106 AGTGGTGGAGAAAGCTGTGGTGG - Intergenic
995451889 5:112311149-112311171 AATGCTGTAGCCGGGTGTGGTGG - Intronic
995617871 5:113986774-113986796 GGTGCTGCAGTAGGCTGTGGAGG - Intergenic
997799530 5:136845972-136845994 AGTAGTGAGGTAGGGTTTGGAGG + Intergenic
997853798 5:137355717-137355739 AGTGGTGTGGGGGGGTGTTGTGG - Intronic
1000064797 5:157685277-157685299 AGTGGTGGAGCCGGGCGTGGTGG + Intergenic
1000621916 5:163495527-163495549 GGTGGTGGAGTTGGGTCTGGAGG + Intergenic
1001732019 5:173967718-173967740 AGGGGTGTCGGAGGGTGAGGAGG + Intergenic
1001772560 5:174307158-174307180 AGTGGTGAGGGGGGGTGTGGCGG + Intergenic
1001907268 5:175483561-175483583 AATGGTGCAATGGGGTGTGGAGG - Intronic
1003313289 6:4987559-4987581 TGTGGTGGAGCAGGATGTGGAGG - Intergenic
1003784591 6:9470570-9470592 AGTGGAGTAGTAGGGGATAGTGG + Intergenic
1004924244 6:20403013-20403035 AGTAGTGAACTGGGGTGTGGGGG + Intronic
1004982530 6:21042257-21042279 GGTGGTGGAGTAGGGTGGGTGGG - Intronic
1005692681 6:28322411-28322433 AGTGGTGTACAGGGGTGGGGTGG - Intergenic
1006442322 6:34060242-34060264 AGTGGTGACCTAGGGTGCGGGGG - Intronic
1006670780 6:35728589-35728611 AGTGGTGGAGTAGGGAGCCGAGG + Intergenic
1006759164 6:36443979-36444001 AGTGTTGTAGTAGTGTCTGTCGG + Intronic
1006996962 6:38270331-38270353 AGAGGGGTAGTGGGGGGTGGGGG - Intronic
1010900829 6:81425129-81425151 AGTGGTGTGGTGGGGAGGGGCGG - Intergenic
1011484025 6:87823684-87823706 ACAGGTGTGGCAGGGTGTGGTGG + Intergenic
1012034101 6:94109521-94109543 AGTGGTGCAGTGGTGTGTAGTGG - Intergenic
1014609534 6:123523827-123523849 AGTGGTGAAAGAGGGAGTGGTGG + Intronic
1015657641 6:135537789-135537811 AGTAGTGGAGTAGGTGGTGGTGG - Intergenic
1015936957 6:138414024-138414046 TGTGGTTAGGTAGGGTGTGGTGG + Exonic
1016196613 6:141351221-141351243 AGTGGTTCAGCCGGGTGTGGTGG - Intergenic
1017033454 6:150245124-150245146 AGTGTGGGAGTAGGGTGTGGCGG - Intronic
1018650929 6:165990555-165990577 GGTGGTGTAGCAGTGTGTGGTGG - Intergenic
1020015460 7:4829009-4829031 AGTGTTGAGGCAGGGTGTGGAGG - Intronic
1020611710 7:10405296-10405318 ACTGGGGTAGTGGGGAGTGGTGG + Intergenic
1022405810 7:30088902-30088924 GGGGGTGTTGTAGGGTGGGGTGG + Intronic
1023016623 7:35974683-35974705 AGTGATGTAATAGAGTGTGGGGG + Intergenic
1023471374 7:40524880-40524902 GGTGGTGTGGTAGAGAGTGGAGG + Intronic
1023742832 7:43295634-43295656 AGTGGTGGAGGAGGGGCTGGTGG + Intronic
1024353934 7:48395322-48395344 AGAGGTCCAGTAGGGTGAGGAGG + Intronic
1025029696 7:55547125-55547147 AGAGCTGTAGGAGGGAGTGGTGG + Intronic
1026923167 7:74171196-74171218 AATGGAGTAGCCGGGTGTGGTGG + Intergenic
1029695834 7:102212660-102212682 GGTGGTGGGGTGGGGTGTGGGGG - Intronic
1031729885 7:125287147-125287169 TGTTGTGTAGAAGAGTGTGGTGG - Intergenic
1032960199 7:137024224-137024246 AGGTGTGTAGTAGGCTGTGATGG - Intergenic
1035751002 8:1996217-1996239 TGTGGTCTAACAGGGTGTGGTGG + Intronic
1037193662 8:16159370-16159392 AATGGTGAAGTAGAGTTTGGTGG - Intronic
1039029357 8:33293043-33293065 AAGGGTGAAGTAGGATGTGGTGG + Intergenic
1040299237 8:46179429-46179451 AATGGTGCAGCAGGGTGTCGTGG - Intergenic
1041248731 8:55914210-55914232 TGAGGTGTAGGAGGGTCTGGAGG + Intronic
1042466131 8:69131840-69131862 AGTGGGGTGGTGGGGTGGGGTGG - Intergenic
1043327728 8:79072944-79072966 AGTGCTTTAGGAGGCTGTGGTGG + Intergenic
1043747038 8:83887439-83887461 AGTGGGGAACTAGGGGGTGGGGG - Intergenic
1043795561 8:84534272-84534294 AGTGGGGAAGTAGGGTGAGGTGG - Intronic
1043999651 8:86864481-86864503 AGTGATGTGGCCGGGTGTGGTGG + Intergenic
1045553055 8:103189826-103189848 AGTGGTGCAATACGGTGTGAGGG + Intronic
1045704742 8:104909024-104909046 AGTGATGCAGTAGGGTGTAGAGG + Intronic
1046066804 8:109207129-109207151 AGTGGAGCAGTAGGGGATGGAGG + Intergenic
1046351819 8:113025296-113025318 TGTGGTTTAGTAGGGTGTTTTGG + Intronic
1047353977 8:124102749-124102771 AGAGGTGAAGTGGGGTGAGGAGG + Intronic
1047499937 8:125432609-125432631 AGGGGTGGGGTCGGGTGTGGGGG + Intronic
1050250377 9:3737443-3737465 AGTGGAGTAGTGACGTGTGGGGG - Intergenic
1050364495 9:4861682-4861704 AGGGGTGTGGGAGGATGTGGAGG + Intronic
1050402199 9:5268094-5268116 ATTGTTGTAGTAAGATGTGGGGG + Intergenic
1055185810 9:73452671-73452693 AGTGTTGGAGGAGGGTCTGGTGG + Intergenic
1055923731 9:81488904-81488926 CCTGGTGTGGTAGGGGGTGGGGG - Intergenic
1056108666 9:83372791-83372813 AGAGGTGTTGGGGGGTGTGGGGG - Intronic
1056266060 9:84897707-84897729 AGTGGTTTGTGAGGGTGTGGAGG - Intronic
1056421255 9:86428766-86428788 AGCTATGTAGTAGGGTGAGGTGG - Intergenic
1056447469 9:86679649-86679671 ATGCGTGTAGAAGGGTGTGGGGG + Intergenic
1056719388 9:89059531-89059553 AGTGGTGTAGGATGTGGTGGAGG + Intronic
1056719565 9:89060293-89060315 AGTGGTGTAGTACGTGGTAGAGG + Intronic
1057666088 9:97046502-97046524 GGTGGGGTAGGAAGGTGTGGAGG - Intergenic
1058917996 9:109586114-109586136 AGTGGAATGGTAGGGCGTGGGGG - Intergenic
1059575300 9:115481741-115481763 AGTGGGGTGGTGGGGTGAGGAGG - Intergenic
1061201470 9:129140786-129140808 AGGGGTGGGGTAGGGTGGGGAGG + Intronic
1203386884 Un_KI270438v1:64268-64290 TGTGGTGAAGTAGAGTGTAGTGG + Intergenic
1203343543 Un_KI270442v1:15255-15277 AGTGGTGAAGTAGAGTATAGTGG + Intergenic
1203343586 Un_KI270442v1:15615-15637 TGTGGTGAAGTAGAGTGTAGTGG + Intergenic
1186363743 X:8870377-8870399 AGAGGTGGAGGAGGATGTGGAGG + Intergenic
1186525160 X:10241616-10241638 AGTGCTTTGGTAGGCTGTGGTGG + Intergenic
1187516187 X:19973515-19973537 AGGGGACTAGTAGGGTGTGTGGG - Intergenic
1187749790 X:22449563-22449585 AGTTGTGAAGTAGGATATGGGGG + Intergenic
1187943324 X:24402403-24402425 AGGGATGTAGCCGGGTGTGGTGG - Intergenic
1188658217 X:32725688-32725710 AGTAGGGTACTAGGGGGTGGAGG + Intronic
1190442095 X:50484883-50484905 AGTGGTGGAGGTGGGAGTGGAGG - Intergenic
1191739968 X:64426013-64426035 CATGGTTTAGTTGGGTGTGGTGG + Intergenic
1192491291 X:71579083-71579105 GGTGGCGTAGGAGCGTGTGGTGG + Intronic
1192980609 X:76335874-76335896 AGTGCTGTAACAGCGTGTGGAGG + Intergenic
1195001132 X:100644535-100644557 ATTGGGGTAGTGGAGTGTGGAGG - Intronic
1196223125 X:113135386-113135408 AGTGGTGGGGTTGGGTGGGGGGG + Intergenic
1196866798 X:120077830-120077852 AGTGGTGTAGTAGGGTGTGGGGG + Intergenic
1196876301 X:120158451-120158473 AGTGGTGTAGTAGGGTGTGGGGG - Intergenic
1198702709 X:139414784-139414806 ATTGGTGTCCTAGGTTGTGGGGG + Intergenic
1199365026 X:146971298-146971320 AGTGGTGTAGGCTGGGGTGGGGG - Intergenic
1199382343 X:147184473-147184495 AGTGGTGTAGGCTGGGGTGGGGG + Intergenic
1200253423 X:154566115-154566137 AGTAGTTTAGCAGGGTGTGGTGG - Intergenic
1200264344 X:154638293-154638315 AGTAGTTTAGCAGGGTGTGGTGG + Intergenic
1200738825 Y:6831116-6831138 AGTGGTCTGGCCGGGTGTGGTGG - Intergenic
1201120578 Y:10869686-10869708 AGTGGAGTGGAATGGTGTGGAGG - Intergenic
1202606458 Y:26643575-26643597 AGTGGTGAAGTGGAGTGTAGTGG + Intergenic