ID: 1196876301 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | X:120158451-120158473 |
Sequence | AGTGGTGTAGTAGGGTGTGG GGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 357 | |||
Summary | {0: 2, 1: 0, 2: 2, 3: 27, 4: 326} |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1196876301_1196876322 | 29 | Left | 1196876301 | X:120158451-120158473 | CCCCCACACCCTACTACACCACT | 0: 2 1: 0 2: 2 3: 27 4: 326 |
||
Right | 1196876322 | X:120158503-120158525 | TGCTCTCCCTCATCCGGGCAAGG | 0: 2 1: 0 2: 0 3: 11 4: 118 |
||||
1196876301_1196876320 | 23 | Left | 1196876301 | X:120158451-120158473 | CCCCCACACCCTACTACACCACT | 0: 2 1: 0 2: 2 3: 27 4: 326 |
||
Right | 1196876320 | X:120158497-120158519 | AACGCGTGCTCTCCCTCATCCGG | 0: 2 1: 0 2: 0 3: 0 4: 47 |
||||
1196876301_1196876321 | 24 | Left | 1196876301 | X:120158451-120158473 | CCCCCACACCCTACTACACCACT | 0: 2 1: 0 2: 2 3: 27 4: 326 |
||
Right | 1196876321 | X:120158498-120158520 | ACGCGTGCTCTCCCTCATCCGGG | 0: 2 1: 0 2: 0 3: 4 4: 84 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1196876301 | Original CRISPR | AGTGGTGTAGTAGGGTGTGG GGG (reversed) | Intergenic | ||