ID: 1196876304

View in Genome Browser
Species Human (GRCh38)
Location X:120158454-120158476
Sequence GTAAGTGGTGTAGTAGGGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 196
Summary {0: 2, 1: 0, 2: 1, 3: 12, 4: 181}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196876304_1196876322 26 Left 1196876304 X:120158454-120158476 CCACACCCTACTACACCACTTAC 0: 2
1: 0
2: 1
3: 12
4: 181
Right 1196876322 X:120158503-120158525 TGCTCTCCCTCATCCGGGCAAGG 0: 2
1: 0
2: 0
3: 11
4: 118
1196876304_1196876321 21 Left 1196876304 X:120158454-120158476 CCACACCCTACTACACCACTTAC 0: 2
1: 0
2: 1
3: 12
4: 181
Right 1196876321 X:120158498-120158520 ACGCGTGCTCTCCCTCATCCGGG 0: 2
1: 0
2: 0
3: 4
4: 84
1196876304_1196876320 20 Left 1196876304 X:120158454-120158476 CCACACCCTACTACACCACTTAC 0: 2
1: 0
2: 1
3: 12
4: 181
Right 1196876320 X:120158497-120158519 AACGCGTGCTCTCCCTCATCCGG 0: 2
1: 0
2: 0
3: 0
4: 47

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196876304 Original CRISPR GTAAGTGGTGTAGTAGGGTG TGG (reversed) Intergenic
900403395 1:2482150-2482172 GTCAGGGGTGTTCTAGGGTGGGG + Intronic
900902796 1:5528177-5528199 CTAAGTGGGGTAGAGGGGTGTGG - Intergenic
901024518 1:6272033-6272055 ATTATTGGTGTTGTAGGGTGGGG - Intronic
902491183 1:16781852-16781874 GGAAGTGGTGTGGAAGTGTGGGG - Intronic
902838367 1:19060512-19060534 ATCTGTGGTGGAGTAGGGTGTGG - Intergenic
904375983 1:30082831-30082853 GTGGGTGGTGTGGTGGGGTGGGG - Intergenic
904974090 1:34442698-34442720 TTGAGTGGTGCAGGAGGGTGGGG - Intergenic
906125333 1:43423853-43423875 GTCAGAGGTGTGGAAGGGTGTGG + Intronic
906125342 1:43423894-43423916 GTAAGGAGTGTGGAAGGGTGTGG + Intronic
906812441 1:48842195-48842217 GGAAATGGGGTGGTAGGGTGAGG - Intronic
912512878 1:110200374-110200396 GTAGGAGGTGTTGTCGGGTGAGG - Exonic
915816360 1:158970424-158970446 GGAAGTGTGGGAGTAGGGTGAGG - Intronic
917659484 1:177163959-177163981 GGAAGTGCTGTAGGTGGGTGTGG + Intronic
918179404 1:182073243-182073265 GAAAGTGGGGAAGGAGGGTGAGG - Intergenic
919733390 1:200928823-200928845 TTTAGTGGTGTAGAGGGGTGGGG + Intergenic
920234431 1:204493645-204493667 GTGTGGGGTGGAGTAGGGTGGGG - Intronic
921182881 1:212645323-212645345 GATAGTGGTGTAGCAGGGAGAGG - Intergenic
922997833 1:229980786-229980808 ATAAGTGGTGGAGAAGGGTCTGG + Intergenic
923529259 1:234800682-234800704 GGAAGTGGTGTGGAAGTGTGGGG + Intergenic
924165542 1:241278429-241278451 TTGAGTGGTGGGGTAGGGTGAGG - Intronic
1064382734 10:14861022-14861044 GCCAGAGGTATAGTAGGGTGAGG + Intronic
1071603818 10:86971433-86971455 GGAAGTGGTGTGGAAGGGAGGGG - Intronic
1072979464 10:100087669-100087691 GTAAGTGGTGGAGGAGGGCCTGG + Intergenic
1074522780 10:114240027-114240049 GTATGTCCTGTAGTGGGGTGTGG - Intronic
1076582724 10:131523614-131523636 GTAAGTGGTGGTGGAGTGTGGGG - Intergenic
1077571058 11:3338958-3338980 CTAAGTGGAGGAGTAGGCTGAGG + Intergenic
1081787389 11:45757024-45757046 GGGAGGGGTGGAGTAGGGTGGGG - Intergenic
1081918086 11:46747267-46747289 GTAAGTGCTATGGTGGGGTGAGG + Intronic
1084729882 11:71066130-71066152 GTGAGTGGGGAAGTTGGGTGGGG + Intronic
1084910850 11:72388084-72388106 GACAGTGGTCTAGCAGGGTGGGG + Intronic
1084962347 11:72723574-72723596 GTAGGTTGGGTAGTAGGATGGGG + Intronic
1087902360 11:103655693-103655715 GTAAGTTGTCTAGTTGGATGTGG - Intergenic
1088172024 11:107009132-107009154 TTCAGTGGTGAAGTTGGGTGGGG - Intronic
1091150816 11:133326697-133326719 GTATATTGTGTAGTGGGGTGTGG + Intronic
1092308576 12:7326764-7326786 GTAAGTGGTTTATGAGTGTGAGG - Intronic
1093271335 12:17066149-17066171 GTTGGTGGTGTAGTAGGAAGAGG + Intergenic
1096848536 12:54420837-54420859 GGAAGTGGAGTAGCAGAGTGAGG - Intergenic
1096973801 12:55686981-55687003 GAAGGTGGGGTAGTAGGGTGAGG - Intronic
1097243811 12:57594572-57594594 GTAAGTGGTATAGTAGAGCCAGG - Intronic
1098981175 12:76957586-76957608 GTGAGTGCTGGAGAAGGGTGAGG - Intergenic
1099895681 12:88643532-88643554 GTAAGTGGTCTAGTAGCTTAAGG + Intergenic
1100631821 12:96397859-96397881 TTAAGTGGTGGAGTAGGGTAAGG + Intronic
1101059083 12:100952232-100952254 GTAAGTGGTGAAGTAGTAAGTGG - Intronic
1104084234 12:125459520-125459542 GGAAGGGTAGTAGTAGGGTGTGG + Intronic
1104236694 12:126945146-126945168 GTAAGAGGTGGAGTGGGATGGGG - Intergenic
1104381339 12:128310551-128310573 GAAGGTGGTGTAATAGCGTGTGG - Intronic
1104491388 12:129196448-129196470 GTAAGTGGGGTAGCATGGGGAGG + Intronic
1107572824 13:41681227-41681249 ATAAGTGAAGGAGTAGGGTGGGG - Intronic
1114948088 14:27712230-27712252 CTAAGTAATGTAGTATGGTGAGG + Intergenic
1117332852 14:54730714-54730736 GTAAGTGGGGTAGAAGGGAGAGG - Intronic
1122770070 14:104093903-104093925 GTGAGTGGGGCTGTAGGGTGTGG + Intronic
1126566585 15:50107757-50107779 GAAAGTGGTGTGGCAGGATGCGG + Intronic
1126672330 15:51127726-51127748 GTAAGTGGAGGACTAGGATGCGG + Intergenic
1128943707 15:71807971-71807993 GTGAGTGGTGGAGGAGGCTGGGG - Intronic
1129411457 15:75352685-75352707 GGAAGTGGTCCAGTTGGGTGAGG + Exonic
1135942270 16:26832354-26832376 GTAAGTGGGGTGATAGGGTAGGG - Intergenic
1136363644 16:29798293-29798315 GTAAGGGGTGGAGTGGGGTGGGG - Intronic
1145748444 17:27337828-27337850 GTAGGAGGTGGAGTTGGGTGGGG + Intergenic
1145863828 17:28227744-28227766 GTAAGTGATGGACCAGGGTGGGG - Intergenic
1149649704 17:58269168-58269190 GGAAGTGGTGTAGGACGGTGGGG - Intergenic
1151315814 17:73321845-73321867 CTATGTGGTGAAGTGGGGTGAGG + Intergenic
1152797458 17:82315235-82315257 GTGAGGGGTGTGGCAGGGTGGGG + Exonic
1157648833 18:49305931-49305953 GTAAGTGATTAAGTAAGGTGAGG - Intronic
1164730406 19:30499952-30499974 GTAGGTGGGGGAGTGGGGTGGGG - Intronic
927670193 2:25062631-25062653 GTAAGTTGTCTAGTAGCCTGCGG - Intronic
927923629 2:26993497-26993519 GAAACTGGTGTAATATGGTGGGG - Intronic
929804110 2:45129574-45129596 ATAAGTGGTGTAGTAGCTGGAGG - Intergenic
931702563 2:64920636-64920658 GAAGGTGGTGATGTAGGGTGTGG - Intergenic
934051006 2:88210814-88210836 GTAAGTTTTGCAGTAGGATGAGG - Intergenic
934850651 2:97698589-97698611 GCAAGTGGAGAAGTAGGCTGGGG + Intergenic
935673643 2:105576136-105576158 GTCATTGGTGTGGTGGGGTGGGG - Intergenic
936133063 2:109863942-109863964 GTAATTGATGTATTAGGGTTGGG - Intergenic
936211634 2:110507543-110507565 GTAATTGATGTATTAGGGTTGGG + Intergenic
936420772 2:112362120-112362142 GTAATTGATGTATTAGGGTTGGG + Intergenic
937326382 2:120991826-120991848 GTAGGTGGTGTGGTTGGGGGTGG + Exonic
938836447 2:135107695-135107717 GTAAGTGGTATGGCTGGGTGCGG + Intronic
939491207 2:142879274-142879296 GCAAGTGGTGGAGTAGGGCAGGG + Intronic
941171828 2:162147153-162147175 GTAAGTGGTTTAGAGGGGTGCGG + Intronic
944465552 2:199996464-199996486 GGAAGTTGTGCAGCAGGGTGGGG + Intronic
1169129128 20:3154830-3154852 GTAAGAGGAGGAGTAGGGGGAGG + Intronic
1170119102 20:12893033-12893055 GTAAGTGGTGAAGTTGAGGGTGG + Intergenic
1172475077 20:35230713-35230735 GTAAGTGCTGTAGTAGGTACTGG - Intronic
1176015116 20:62926893-62926915 GTAAGAGGTGTAGGGGGGCGGGG + Intronic
1176913830 21:14600871-14600893 GTAAGAGGAGAAGGAGGGTGAGG + Intronic
1182203129 22:28593874-28593896 GGTAGTGGTGGAGTAGGGAGGGG + Intronic
1185326073 22:50226498-50226520 GTGAGAGGTGGAGTGGGGTGTGG + Intronic
949711471 3:6875744-6875766 GCCAGGGGTGAAGTAGGGTGGGG + Intronic
949815205 3:8050878-8050900 GTAAATGGTGAAGGAGGGTGGGG + Intergenic
950427609 3:12932921-12932943 GAAAGTGGTGTAGGTTGGTGGGG - Intronic
953164009 3:40447998-40448020 GTGAGTGGTGTGGTGGGGGGAGG + Intergenic
955506391 3:59637160-59637182 GTAAGACGTGGAGTAGGCTGTGG + Intergenic
955637223 3:61043246-61043268 AAAAGTGCTGTATTAGGGTGGGG - Intronic
955688280 3:61565400-61565422 GTGAGTGTTGAAGTTGGGTGGGG - Intronic
956026881 3:64992661-64992683 GTAAGTAGGGCAGTGGGGTGGGG + Intergenic
957791114 3:84942272-84942294 GGGACTGGTGTAGTTGGGTGGGG - Intergenic
958461288 3:94399654-94399676 GTAAATGATGTCTTAGGGTGGGG - Intergenic
958529723 3:95311110-95311132 GTAAGTAGTGAAGTATGGTTGGG - Intergenic
958893255 3:99803806-99803828 GGAGGTGAAGTAGTAGGGTGTGG + Intergenic
962086079 3:132193214-132193236 GAAAGTATAGTAGTAGGGTGGGG - Intronic
962269608 3:133968096-133968118 GTGAGTGGAGTTGTGGGGTGAGG - Intronic
965727991 3:171739794-171739816 GTAAGTGGTGAAGAAGGGACTGG + Intronic
965892986 3:173538096-173538118 GTAAGTGGTGTAATAGTGACTGG + Intronic
967576266 3:191097100-191097122 GTAAAAGGTGTAGGAGGGTGAGG - Intergenic
972257145 4:37369400-37369422 GGAAGTGGGGGAGAAGGGTGAGG - Intronic
972522447 4:39872329-39872351 GTAAGTGGATTAGCCGGGTGTGG - Intronic
975293913 4:72709780-72709802 GTAAGTGGAAAAGTTGGGTGAGG - Intergenic
975841171 4:78475607-78475629 GTAGGTGGGGTAGTGGGGTTGGG + Intronic
977454156 4:97236470-97236492 GTAAGTGATATAGTAGTTTGTGG - Intronic
978315277 4:107428710-107428732 GAAAGTGGTATAGTTGGATGTGG + Intergenic
982959675 4:161821559-161821581 GTAAGTGTGGGAGGAGGGTGAGG - Intronic
986135974 5:4978332-4978354 GTTAGTGGGTTAGTAGGGTATGG - Intergenic
987817184 5:22917740-22917762 CGAGGTGGTGGAGTAGGGTGGGG + Intergenic
989174609 5:38511187-38511209 GTAAGTTGTTTTTTAGGGTGTGG - Intronic
989774434 5:45186182-45186204 GAAAGTGGTGTAGCAAGTTGAGG - Intergenic
992170197 5:74093749-74093771 GGAGGTGCTGTTGTAGGGTGTGG - Intergenic
993815014 5:92532858-92532880 GTAAGTGGACTAGTAGGGAGAGG - Intergenic
998050351 5:139027366-139027388 AGAAGTGGAGAAGTAGGGTGTGG - Intronic
999371174 5:151056330-151056352 GTAAATGGTGAAGTAGGGATTGG - Intronic
999431177 5:151526787-151526809 GTAAGTGGTGAAGGGAGGTGAGG - Intronic
1000840284 5:166209508-166209530 GTAAGTGTTGTGGTAGGAAGGGG - Intergenic
1001732018 5:173967715-173967737 ATAAGGGGTGTCGGAGGGTGAGG + Intergenic
1001960922 5:175880058-175880080 GTAACAGGTGGAGTAGGCTGGGG - Exonic
1003414399 6:5895106-5895128 GCAAGTGGGTTAGGAGGGTGAGG - Intergenic
1004054736 6:12123978-12124000 GTAAGTGGTGTTGTCTGGGGTGG - Exonic
1005692682 6:28322414-28322436 GCAAGTGGTGTACAGGGGTGGGG - Intergenic
1007203214 6:40128785-40128807 GTGAGTTGTGTTGGAGGGTGAGG - Intergenic
1008209292 6:48701722-48701744 GGAAGCGGTTTAGTAGGCTGAGG + Intergenic
1009968143 6:70599184-70599206 GCCAGTGCTGTAGTGGGGTGTGG - Intergenic
1010489121 6:76452923-76452945 GTGGGTGGTGGAGTGGGGTGGGG + Intergenic
1017365620 6:153633262-153633284 GTAGTTGGTGTGGTAGGCTGGGG - Intergenic
1017918553 6:158852468-158852490 GCAGGTGTTGTAGTAGGGTTAGG - Intergenic
1019173111 6:170145985-170146007 GTGAGGTGTGTAGGAGGGTGAGG + Intergenic
1019173115 6:170146002-170146024 GTGAGGTGTGTAGGAGGGTGAGG + Intergenic
1019173119 6:170146019-170146041 GTGAGGTGTGTAGGAGGGTGAGG + Intergenic
1019173123 6:170146036-170146058 GTGAGGTGTGTAGGAGGGTGAGG + Intergenic
1019173127 6:170146053-170146075 GTGAGGTGTGTAGGAGGGTGAGG + Intergenic
1019173131 6:170146070-170146092 GTGAGGTGTGTAGGAGGGTGAGG + Intergenic
1019173135 6:170146087-170146109 GTGAGGTGTGTAGGAGGGTGAGG + Intergenic
1019173139 6:170146104-170146126 GTGAGGTGTGTAGGAGGGTGAGG + Intergenic
1019173143 6:170146121-170146143 GTGAGGTGTGTAGGAGGGTGAGG + Intergenic
1019173147 6:170146138-170146160 GTGAGGTGTGTAGGAGGGTGAGG + Intergenic
1019173151 6:170146155-170146177 GTGAGGTGTGTAGGAGGGTGAGG + Intergenic
1019173155 6:170146172-170146194 GTGAGGTGTGTAGGAGGGTGAGG + Intergenic
1019173159 6:170146189-170146211 GTGAGGTGTGTAGGAGGGTGAGG + Intergenic
1019173171 6:170146240-170146262 GTGAGGTGTGTAGGAGGGTGAGG + Intergenic
1019173175 6:170146257-170146279 GTGAGGTGTGTAGGAGGGTGAGG + Intergenic
1019173179 6:170146274-170146296 GTGAGGTGTGTAGGAGGGTGAGG + Intergenic
1019173187 6:170146308-170146330 GTGAGGTGTGTAGGAGGGTGAGG + Intergenic
1019173191 6:170146325-170146347 GTGAGGTGTGTAGGAGGGTGAGG + Intergenic
1019173203 6:170146376-170146398 GTGAGGTGTGTAGGAGGGTGAGG + Intergenic
1019173207 6:170146393-170146415 GTGAGGTGTGTAGGAGGGTGAGG + Intergenic
1019173211 6:170146410-170146432 GTGAGGTGTGTAGGAGGGTGAGG + Intergenic
1019173215 6:170146427-170146449 GTGAGGTGTGTAGGAGGGTGAGG + Intergenic
1021277217 7:18666780-18666802 GTAATTGGTGTAGCAGGCTTTGG - Intronic
1021396869 7:20159856-20159878 CTAAGTCGTGTAGTAGGATCTGG + Exonic
1022582436 7:31569294-31569316 GGAAGTTGTGAAGTAGTGTGGGG - Intronic
1025000784 7:55312989-55313011 GTCAGTAGTGTACCAGGGTGAGG - Intergenic
1026469687 7:70684605-70684627 GTGTGTGGTGTGGTATGGTGTGG + Intronic
1029266988 7:99350130-99350152 GGAAGTGGGGTAGGAGGGAGAGG + Intronic
1030130502 7:106195555-106195577 GTGAGGGGTGGCGTAGGGTGGGG - Intergenic
1032384318 7:131510971-131510993 CTAAGTGGACTTGTAGGGTGAGG + Exonic
1039459123 8:37728736-37728758 GCGAGTGGTGTTGAAGGGTGGGG - Intergenic
1041306962 8:56471570-56471592 ATATGTGGTGTAGTGGGGGGAGG - Intergenic
1041396594 8:57397904-57397926 GTAAGTGGAGTCGAAGGGAGAGG + Intergenic
1043795562 8:84534275-84534297 TTAAGTGGGGAAGTAGGGTGAGG - Intronic
1044608454 8:94068478-94068500 GTATGTGGTGTGGTGTGGTGTGG - Intergenic
1045192229 8:99894208-99894230 GAAAGTGGTGTAGAAGGGTGAGG + Intergenic
1047075040 8:121391814-121391836 GTAAATGATGTCATAGGGTGGGG + Intergenic
1047303940 8:123638144-123638166 GGGAGTGGTGGAGTAGGGTGAGG - Intergenic
1047623973 8:126636558-126636580 TTAAGTGGTATAATAAGGTGAGG + Intergenic
1048964967 8:139608663-139608685 GTACGTTGTGTAGTAGAATGTGG - Intronic
1050641968 9:7677929-7677951 GTAGGTGGGGTGGTGGGGTGAGG + Intergenic
1052527876 9:29643595-29643617 GTAAGTGGAGGAGTAGATTGGGG - Intergenic
1055336599 9:75238424-75238446 CTAAGTGCTGTAGCTGGGTGGGG - Intergenic
1056655098 9:88502665-88502687 GTAAATGGAGCAGTAGAGTGAGG - Intergenic
1057888596 9:98850951-98850973 GTAAGGGGTGGGGTGGGGTGGGG - Intergenic
1059524403 9:114976982-114977004 GGGAGTGGTGCACTAGGGTGCGG + Intergenic
1060009346 9:120029826-120029848 GTTAGTGATGGGGTAGGGTGGGG + Intergenic
1060778592 9:126394935-126394957 GTGTGTGGTGTAGTAGGGGGCGG + Intronic
1061201469 9:129140783-129140805 GGAAGGGGTGGGGTAGGGTGGGG + Intronic
1188835387 X:34948335-34948357 TGAAGCGGTGCAGTAGGGTGAGG - Intergenic
1189105200 X:38228436-38228458 GTTGGTGTCGTAGTAGGGTGTGG - Intronic
1190993677 X:55582245-55582267 GGAAGTGTTGAAGGAGGGTGAGG + Intergenic
1191720762 X:64226654-64226676 ATGAGTGGTTTTGTAGGGTGAGG - Intronic
1192222259 X:69205409-69205431 GTGAGTGCAGTAGTAGGGTTGGG - Intergenic
1193096317 X:77553476-77553498 GTAAGTTGTGTTATAGGTTGTGG - Intronic
1193915410 X:87356904-87356926 GAAAGTGGAGTAGGGGGGTGGGG + Intergenic
1194707955 X:97199017-97199039 GTAAGTGCTTTGGGAGGGTGGGG + Intronic
1195499430 X:105577651-105577673 GTGAGGGTTGTAGGAGGGTGAGG - Intronic
1195720859 X:107866763-107866785 GTAAGTGCTGTAGTAGTTCGGGG + Intronic
1196716092 X:118812358-118812380 GCAAGTGGGGGAGGAGGGTGGGG - Intergenic
1196734817 X:118974380-118974402 GGAAGTGGGGTTGTGGGGTGGGG - Intergenic
1196866795 X:120077827-120077849 GTAAGTGGTGTAGTAGGGTGTGG + Intergenic
1196876304 X:120158454-120158476 GTAAGTGGTGTAGTAGGGTGTGG - Intergenic
1199035368 X:143043746-143043768 GTATCTAGTGTAGTTGGGTGGGG + Intergenic
1200122210 X:153796461-153796483 AGAAGTGGTGTAGTAGGAAGGGG - Exonic