ID: 1196876306

View in Genome Browser
Species Human (GRCh38)
Location X:120158460-120158482
Sequence GGAGGGGTAAGTGGTGTAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 249
Summary {0: 2, 1: 0, 2: 0, 3: 15, 4: 232}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196876306_1196876322 20 Left 1196876306 X:120158460-120158482 CCTACTACACCACTTACCCCTCC 0: 2
1: 0
2: 0
3: 15
4: 232
Right 1196876322 X:120158503-120158525 TGCTCTCCCTCATCCGGGCAAGG 0: 2
1: 0
2: 0
3: 11
4: 118
1196876306_1196876320 14 Left 1196876306 X:120158460-120158482 CCTACTACACCACTTACCCCTCC 0: 2
1: 0
2: 0
3: 15
4: 232
Right 1196876320 X:120158497-120158519 AACGCGTGCTCTCCCTCATCCGG 0: 2
1: 0
2: 0
3: 0
4: 47
1196876306_1196876321 15 Left 1196876306 X:120158460-120158482 CCTACTACACCACTTACCCCTCC 0: 2
1: 0
2: 0
3: 15
4: 232
Right 1196876321 X:120158498-120158520 ACGCGTGCTCTCCCTCATCCGGG 0: 2
1: 0
2: 0
3: 4
4: 84

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196876306 Original CRISPR GGAGGGGTAAGTGGTGTAGT AGG (reversed) Intergenic
900898579 1:5501696-5501718 GGTGGGGGAAGTGGTGGGGTCGG - Intergenic
900939935 1:5792175-5792197 GGAGGGGTAGCGGCTGTAGTGGG - Intergenic
901469203 1:9443922-9443944 GGAGGGGTAAGGGGAGAAGGAGG - Intergenic
901561167 1:10072076-10072098 GGAGAGGTGAGTGGGGTGGTTGG - Exonic
902963690 1:19982523-19982545 GGAGGGGTATCTGGAGTAGGAGG + Intergenic
904256754 1:29259366-29259388 GCAGGGGTAAGGGGTGTGGGCGG + Intronic
905411171 1:37769317-37769339 GGAAGATTAAGTGGTGAAGTAGG + Intergenic
905447447 1:38036281-38036303 GGATGGGTAAGTGGTTGAATAGG + Intergenic
905652841 1:39668142-39668164 GGTGGGGTTGGTGGTGGAGTGGG + Intronic
908011913 1:59786653-59786675 GGAGGAAAAAGTGGTGTTGTGGG - Intergenic
908933017 1:69340215-69340237 GGAGGGAAAAATGGTGTTGTGGG + Intergenic
910081431 1:83347170-83347192 GGAGGGGGAAGTGGTGCTTTTGG + Intergenic
910409645 1:86926683-86926705 TGAGGGGAAAGTAGTGAAGTTGG + Intronic
910547851 1:88439308-88439330 GCAGGGGGAAGTGGGGAAGTGGG + Intergenic
911082845 1:93950321-93950343 GGAGGGAAAAATGGTTTAGTGGG - Intergenic
912635363 1:111286949-111286971 GGAGGGCTAAGTGAGGTAGAAGG + Intergenic
916424992 1:164671697-164671719 GGAGTGGTAAGTGGTGGGGGAGG + Intronic
917599299 1:176558805-176558827 GGAGGGGTAAGCAGAGTCGTGGG - Intronic
918552638 1:185761115-185761137 GGAAGGGGCAGAGGTGTAGTTGG + Intronic
922502113 1:226104871-226104893 GGAGGGGTGACTGGAGTAGGAGG - Intergenic
924446821 1:244140602-244140624 GGATGGGTGAGTGGGGTAGGTGG - Intergenic
1062885176 10:1010900-1010922 GGTGGGGAAGGTGGTGTAGGGGG - Intronic
1064281634 10:13956551-13956573 GCACGGGTAAATGGTGGAGTTGG + Intronic
1064940109 10:20724659-20724681 GGAGAGGTAAGTGGGGGAGAAGG - Intergenic
1065343069 10:24723963-24723985 GGAGGGGAAGGAGGTGGAGTGGG - Intergenic
1071877762 10:89861321-89861343 GGAGGGGGAAGAGGAGGAGTAGG - Intergenic
1072392208 10:94998522-94998544 GGTGGGGTAAGTAGTTTGGTGGG + Intergenic
1073540715 10:104314722-104314744 GGAGGAGTAGGAGGTGCAGTAGG + Exonic
1073563470 10:104516402-104516424 GGAGGTGTCAGTGGTGTTGATGG + Intergenic
1074794488 10:116927810-116927832 GGAGGGGGAAGTGGTGGTGGAGG + Exonic
1076183285 10:128427305-128427327 GGTGGGGAAAGTGAGGTAGTGGG - Intergenic
1076559354 10:131351096-131351118 GGAGGGGAAAGTGCTGTCTTTGG + Intergenic
1077187810 11:1243308-1243330 GGAGGGGTTGGTGGTGGAGCCGG - Exonic
1077188233 11:1244979-1245001 GGAGGGGTTGGTGGTGGAGCCGG - Exonic
1077188765 11:1247079-1247101 GGAGGGGTTGGTGGTGGAGCCGG - Exonic
1077189187 11:1248750-1248772 GGAGGGGTTGGTGGTGGAGCCGG - Exonic
1077189755 11:1250949-1250971 GGAGGGGTTGGTGGTGGAGCCGG - Exonic
1080392984 11:31865435-31865457 GGAGGGGACAGTGGTGGAGAAGG + Intronic
1080920862 11:36708177-36708199 TGATGGGTAAGTGGAGTGGTAGG + Intergenic
1080946774 11:36982320-36982342 GGAGGGAAAAATGGTTTAGTGGG - Intergenic
1084150711 11:67286725-67286747 GGAGGGGTAGGAGGGGAAGTGGG - Intergenic
1084522771 11:69674769-69674791 GGAGGGAAAAGGGGTGTGGTCGG + Intronic
1086100362 11:83092893-83092915 GAAGGTGGAGGTGGTGTAGTTGG + Intergenic
1086862983 11:91947183-91947205 GGAGGGGCAGGTGGTGCAGGTGG + Intergenic
1086995458 11:93351129-93351151 GGATGGGTAGTTGGGGTAGTTGG + Intronic
1087505646 11:99017880-99017902 AGTGGGGTAAGTGGTTCAGTAGG - Intergenic
1088914093 11:114213858-114213880 GCAGTAGTAAGTGGTGAAGTGGG + Intronic
1089118835 11:116117770-116117792 GGAGGGGAAAGTGGAATGGTGGG - Intergenic
1089170413 11:116507744-116507766 GCAGGGGTAAGTGTTATACTGGG - Intergenic
1090210662 11:124919345-124919367 GGAGGGGTAAGTAAGGAAGTGGG - Exonic
1093380125 12:18481720-18481742 GGAAGAGTAAGTGGTGGAGAGGG + Intronic
1093591324 12:20905224-20905246 GGAGGGTTAAATGGTTTTGTGGG - Intronic
1095120898 12:38417363-38417385 GGCAGGGTAAGTAGTTTAGTGGG - Intergenic
1095937094 12:47696600-47696622 GGAGGGGGAAGGGGAGGAGTTGG - Intronic
1096144808 12:49271151-49271173 GGAGGCTTAACTGGTGTAATTGG + Intronic
1096220679 12:49826831-49826853 GGAGGGGCAGGTGCTGTGGTTGG - Intronic
1098842136 12:75489297-75489319 GGAGTGGTCAGTGATGTAGGAGG - Intronic
1099111973 12:78573126-78573148 GGAGGGGTAAGTGCAGAAGTAGG - Intergenic
1099300769 12:80891778-80891800 GGAGGTGTAAGTGGAGAAGGAGG + Intronic
1099501420 12:83418828-83418850 GGAGGAAAAAGTGGTTTAGTGGG + Intergenic
1101340327 12:103837267-103837289 GGAGGGAAAAGTGGTTTAGTGGG - Intronic
1104616367 12:130273337-130273359 GGAGGGGTAAGGGGAGGAGGAGG - Intergenic
1105611299 13:21971793-21971815 TGTGGGGTATGTGGTGTATTGGG + Intergenic
1106756030 13:32823908-32823930 TGGGGGGTGAGTGGGGTAGTGGG + Intergenic
1107725129 13:43291633-43291655 GCAGGGGGAAGTGGTGCAGTGGG - Intronic
1110610747 13:77485233-77485255 GGAAGGGTAAGTGGGGAAGAGGG - Intergenic
1112512208 13:100020017-100020039 GGAGGGGTAAATTGTTTTGTGGG + Intergenic
1112551718 13:100427692-100427714 AGAGAGGTAAATGGTGTACTAGG + Intronic
1112946008 13:104927821-104927843 GGAGGGGGAAGGGGTGGAGTAGG + Intergenic
1116040493 14:39680452-39680474 TGAGGAGTTAGTGCTGTAGTAGG + Intergenic
1116396044 14:44449709-44449731 GGTGGGGTAAGTGGTTTGGAGGG + Intergenic
1116551236 14:46241515-46241537 CGAGGGGTGAGTGGTGGAGAAGG - Intergenic
1117084571 14:52186110-52186132 GGAGGGGAAAGTGGAGAAGGAGG - Intergenic
1120451974 14:84680332-84680354 GGATGGGGAAATGGTGCAGTTGG - Intergenic
1121041268 14:90750579-90750601 GGAGGATTAAGTTGTGTAGCTGG - Intronic
1121807946 14:96848474-96848496 GGAGGGGTAAGTAGTTGGGTAGG + Intronic
1122244590 14:100393537-100393559 GGAGGGGAACGAGGTGTATTCGG + Intronic
1202849459 14_GL000225v1_random:8051-8073 CGAGGGGGAAGTGGTGAGGTGGG - Intergenic
1123973145 15:25527978-25528000 GGAGGTGGAGGTGGTGGAGTTGG + Intergenic
1125881346 15:43198765-43198787 GGAGGAAAAAGTGGTTTAGTGGG + Intronic
1127145036 15:56014879-56014901 GGAGGGAAAAATGGTTTAGTGGG - Intergenic
1128704075 15:69825876-69825898 GGAGGGGGAAGTGGTGGGGCAGG - Intergenic
1128910193 15:71506945-71506967 GCAGGGGGAAGTGGAATAGTGGG + Intronic
1130078460 15:80710265-80710287 GCAGGGGTAAGAGGAGTAGTAGG + Intronic
1130744392 15:86635334-86635356 GGAGGAGTAAGAGGAGTAGGAGG - Intronic
1131303926 15:91224398-91224420 GGTGGGGTAGGGGGTGTAGGAGG + Intronic
1132154926 15:99488921-99488943 AGAGGGGTAAGGGGTCTGGTGGG + Intergenic
1136290995 16:29271213-29271235 GGATGGGTAAGTGGATGAGTGGG + Intergenic
1136928715 16:34399096-34399118 GGAGTGGGGAGTGGTGGAGTAGG - Intergenic
1136975859 16:35012708-35012730 GGAGTGGGGAGTGGTGGAGTAGG + Intergenic
1137716022 16:50598766-50598788 GGTGGGGCCAGTGGTGTGGTGGG + Intronic
1137716048 16:50598894-50598916 GGTGGGGTCAGTGGTGTGGTGGG + Intronic
1137716062 16:50598943-50598965 GGTGGGGTCAGTGGTGTGGTGGG + Intronic
1138412622 16:56851981-56852003 GGTAGGGTCAGTGGTGTGGTGGG - Intergenic
1141615938 16:85209488-85209510 GGAGGGGTCAGTGGTCCAGGGGG - Intergenic
1141686363 16:85572323-85572345 GGAGGGGTATGTGGTGTGTGTGG - Intergenic
1141808473 16:86357980-86358002 GGAGGGGAAAGAGGGGTAGGGGG - Intergenic
1142096870 16:88244715-88244737 GGATGGGTAAGTGGATGAGTGGG + Intergenic
1142398165 16:89844881-89844903 GGAGGGGCAGGTGGAGTAGGAGG - Intronic
1143061092 17:4201697-4201719 GGTGGGGTAAGGGGTGCAGAAGG + Intronic
1144078022 17:11736462-11736484 GGAGGGGGAAGTGGAGAAGCAGG - Intronic
1144398520 17:14870483-14870505 GGAGGGGGAAGAGGAGGAGTTGG + Intergenic
1144521153 17:15953064-15953086 GGAGGGTTGAGTGGTGTGGTAGG + Intronic
1144572431 17:16407970-16407992 GGAGGGGTCAGTGGTGGGGGAGG + Intergenic
1146674550 17:34764377-34764399 GGAGGGGAACCTGGTATAGTGGG - Intergenic
1147268922 17:39253175-39253197 GGATGGGTAAATGGTGCTGTTGG - Intergenic
1152630937 17:81410448-81410470 GTAGGGGTAAGTGGGGCAGCTGG - Intronic
1153753355 18:8256175-8256197 TGAGTGCTAACTGGTGTAGTGGG + Intronic
1156008538 18:32470786-32470808 GGAGGGGTAAGAGGAGGAGGAGG - Intergenic
1156208640 18:34913866-34913888 GGAGGGGAAGGTGATGGAGTGGG - Intergenic
1157712629 18:49860304-49860326 GGATGGGGAAGTGGTTTAGGAGG - Intronic
1158643041 18:59219775-59219797 GGAGGGGTGGGGGGTGTAGCTGG - Intergenic
1161216901 19:3099169-3099191 GGAGAGGTGTGTGGTGGAGTCGG + Intronic
1162491550 19:10995507-10995529 GGAGGGGGAAGTGGAGTGGAAGG + Intronic
1163929537 19:20375797-20375819 GACGGGGTAAGTGGTTTGGTAGG - Intergenic
1166737870 19:45096920-45096942 GGAGGGGTCATTGGTGAAGTTGG + Intronic
1167367069 19:49060168-49060190 GGAGGGGTAAGTGGGATCCTGGG - Intronic
1167472961 19:49685634-49685656 GGAGGAGTAAGTTGTTGAGTGGG + Intronic
1167780814 19:51597796-51597818 GGAGGGGTCAGTGATGGGGTTGG - Intergenic
927450548 2:23205933-23205955 GGAGAGGTAAGAGCTGGAGTTGG - Intergenic
927621816 2:24669052-24669074 GGAGGGGTAATTTGTATAGCAGG + Intronic
927718931 2:25370869-25370891 GGAGGGGGAAGGGGTGGAGGGGG - Intergenic
929078787 2:38101204-38101226 AGAGGGGAAAGTGGTGCAGTAGG + Intronic
929889466 2:45907060-45907082 GGAGGTCTAAGTGGTATAGACGG + Intronic
930503738 2:52255935-52255957 GGAGGAAAAAGTGGTTTAGTGGG - Intergenic
932568765 2:72925615-72925637 GGAGGGGACGGTGGTGTAGTAGG - Intronic
934653914 2:96107676-96107698 GGAGGGGCAAGTGGGGAGGTGGG - Intergenic
935943395 2:108264943-108264965 GGTGGGCAAAGTGGTATAGTTGG - Exonic
938077055 2:128345696-128345718 GGAGGGGTGGGTGGTGTGGCCGG + Intergenic
938292422 2:130157198-130157220 GGAGGGGAAAGTGGGGGAGACGG + Intronic
938464132 2:131515778-131515800 GGAGGGGAAAGTGGGGGAGACGG - Intergenic
940936667 2:159503313-159503335 GGAGGAGACAGTGGTGTATTTGG - Intronic
941157513 2:161997326-161997348 GGAGGGATAAATGGTGATGTTGG - Intronic
941171826 2:162147147-162147169 GGTTGGGTAAGTGGTTTAGAGGG + Intronic
944011500 2:194979765-194979787 GGAGGGGAAAATGGTTTTGTGGG - Intergenic
945547515 2:211174733-211174755 GGAGGGGTAAAGGGTGTACCCGG + Intergenic
947309730 2:228788096-228788118 GGAGGGGGAAGAGGAGGAGTTGG - Intergenic
948806022 2:240453672-240453694 GGAGGGGGCACTGGTGCAGTGGG - Intronic
1169858035 20:10124432-10124454 GGAGGAATAAGTGGTTTTGTGGG - Intergenic
1171182994 20:23104580-23104602 GGAGGGGAAAGGGGTGTAGCAGG + Intergenic
1172036126 20:32011879-32011901 GGAGGGGTAAGTATTTTTGTTGG - Intronic
1172196002 20:33092004-33092026 GGTGGGGGTAGTGGTGTTGTGGG + Intronic
1173103235 20:40107144-40107166 GGAGTGGAAAGTGGTGTGGCTGG + Intergenic
1173357121 20:42304101-42304123 GGAGAGGCAAGTGGAGAAGTGGG - Intronic
1173781121 20:45758375-45758397 CGAGAGGTGAGTGGTGGAGTGGG - Intronic
1175058674 20:56221430-56221452 GGCGGGGTAAGTAGTTTGGTGGG - Intergenic
1179970832 21:44836117-44836139 GGTGGGGTCAGGGGTGTGGTGGG - Intergenic
1179970899 21:44836254-44836276 GGTGGGGTCAGGGGTGTGGTGGG - Intergenic
1180617400 22:17137450-17137472 GGAGGAGTGAGTGGTGTGGGCGG - Intergenic
1182816775 22:33171483-33171505 GGAGGGAAAAGTGGTTTTGTGGG + Intronic
1183308584 22:37097289-37097311 GGTGGGGCAAGTGGTTTATTTGG + Intronic
949850152 3:8412781-8412803 GGAGGGATAAGTGGGGGTGTGGG - Intergenic
949949154 3:9215015-9215037 GGAGAGCTAAGTGGTGGAGGGGG + Intronic
950990714 3:17434646-17434668 GGAGGGAAAAGTGGTTTTGTGGG - Intronic
953357055 3:42264915-42264937 AGAGGGGGAGGTGGTCTAGTGGG + Intronic
955374351 3:58381900-58381922 GCAGGGGTAAGGGGTGTCATGGG + Intronic
956699173 3:71943759-71943781 GGAGGGGGAAGAGGAGGAGTTGG + Intergenic
957145085 3:76413192-76413214 GGAGGGAAAAGTGGTTTCGTGGG - Intronic
960301000 3:116002485-116002507 GTAGGGGTATGTGGTGCAGCTGG - Intronic
961356887 3:126344977-126344999 GGAGGGGTAGGTGGGGTGGGAGG - Intronic
961419804 3:126793490-126793512 GGAGGGGAAAGGGATGTAATTGG - Intronic
961427881 3:126861950-126861972 GGAGGGGGAAGTGGTGATGGTGG - Intronic
961428362 3:126863591-126863613 GGAGGGGGAAGTGGTGATGGTGG - Intronic
962931466 3:140041501-140041523 AGAGGGGTAGGTGGTGGAGGAGG + Intronic
963517074 3:146322627-146322649 GGAGGGATAAATGGTTTTGTGGG + Intergenic
964187824 3:153967618-153967640 GTAGGGGTAAGTGGGGTGATGGG - Intergenic
965929762 3:174028852-174028874 GGAGGGATAAATGGTTTTGTGGG + Intronic
966446942 3:180011074-180011096 GGAAGGGAAAGTGGTGTGGATGG - Intronic
966660431 3:182408545-182408567 TGAGAGGAAAGTGGTGTGGTCGG + Intergenic
969016756 4:4108404-4108426 CGAGGGGTGAGAGGTGTGGTGGG + Intergenic
970119161 4:12733238-12733260 AGAGGTGTAACTGGTGTGGTTGG + Intergenic
970157269 4:13153690-13153712 GGAGGAGAAAGTGGTTTCGTGGG - Intergenic
970434633 4:16021816-16021838 GCTGGGGGAAGTGGTGGAGTTGG - Intronic
971217389 4:24673945-24673967 GGAGGAGTAAGAAGTGTAGCAGG - Intergenic
974029273 4:56761780-56761802 GGAGGAGTAATTGGGGAAGTTGG - Intergenic
977953558 4:103001223-103001245 GGAGGAGAAAGTGGTTTTGTGGG - Intronic
978232406 4:106415913-106415935 GAAGAGGTGAGTGGTGTAGGAGG + Intergenic
978392680 4:108243447-108243469 TGAGGGGTAAATGGTGAAGGTGG + Intergenic
979500521 4:121434653-121434675 GGAGGAAAAAGTGGTTTAGTGGG - Intergenic
981790255 4:148528165-148528187 GGAGGGGTAGACAGTGTAGTAGG + Intergenic
982746263 4:159105904-159105926 GAAGGGGGAAGTGGTGCATTTGG + Intronic
983723879 4:170893749-170893771 GGAGGAGAAAGTGGTTTTGTGGG - Intergenic
984723121 4:182995074-182995096 GGAGGAGAAAGTGGAGGAGTTGG - Intergenic
987792091 5:22581214-22581236 GGAGGAATAAGTGGTTTTGTGGG + Intronic
988002159 5:25362744-25362766 GGAGGGGTAAATGGTGAATAGGG + Intergenic
988925078 5:35981868-35981890 GGAGGGGAAAATGGTTTTGTGGG + Intronic
989236199 5:39151202-39151224 GCAGAGGTAAGTGGTGGAGGTGG - Intronic
990097383 5:52134111-52134133 GAAAGGGAAAGTGGTGGAGTGGG - Intergenic
990376804 5:55178305-55178327 GGAGGTGTTGGTGGTGTTGTGGG - Intergenic
990860678 5:60323449-60323471 GGAGGGGTATCAGATGTAGTTGG - Intronic
992168660 5:74080084-74080106 GTAGGGGTCACTGGGGTAGTGGG + Intergenic
998418376 5:141961721-141961743 GGAGGGCTGAGGGGTGAAGTGGG + Intronic
999309359 5:150541828-150541850 GGAGGGGAAAGAGGTGGAGGAGG + Intronic
999981758 5:156964361-156964383 GGAGGGTTGAGTGGTTTTGTTGG - Intergenic
1000433827 5:161183333-161183355 GGAAGGGTAAGAGGGGTTGTGGG + Intergenic
1001565331 5:172696267-172696289 CGAGGGGTAGCTGGTGTAGCAGG - Intergenic
1002493544 5:179596805-179596827 GCAGGGGTGAGTGGTGAAGCAGG - Intronic
1004461445 6:15840741-15840763 GGAGGGGTATGGGGTGGAGGTGG - Intergenic
1005017794 6:21390586-21390608 GGAGGGGTGAGTGTCTTAGTCGG - Intergenic
1006426743 6:33968103-33968125 GGAGTGGTAAAAGCTGTAGTGGG - Intergenic
1008285647 6:49646280-49646302 GAAGGGGTAGGTGGTGGAGGAGG + Intergenic
1008332777 6:50262726-50262748 GGAGGGAAAAATGGTTTAGTGGG - Intergenic
1008561041 6:52724999-52725021 GGAGGGGTCAGTGAAGTAGAAGG - Intergenic
1009503004 6:64441520-64441542 AGAGGTGGAAGTGGTCTAGTCGG + Intronic
1010154525 6:72777407-72777429 GGTGGGGTAAGTGGAGTGGGTGG + Intronic
1010735891 6:79443298-79443320 GGAGGAATAAGTGGTTTCGTGGG - Intergenic
1012670329 6:102037269-102037291 TGAGGGGTTAATGGTGTAATTGG + Intronic
1013936592 6:115603611-115603633 GGAGGGGAAGGTGGGGAAGTTGG - Intergenic
1016470523 6:144370239-144370261 GGAGGGAAAAATGGTTTAGTGGG + Intronic
1016613711 6:146023893-146023915 GGAGAGGTAAATGGTTTAATGGG + Intergenic
1018374666 6:163199646-163199668 GGAGGAGTAAATGGTGGAGGTGG + Intronic
1018880171 6:167869840-167869862 GGAGAGGTAAGTGTTGAAGTGGG + Intronic
1018993924 6:168696059-168696081 GGAGGGTCAAGTGGTGGAGAGGG - Intergenic
1020035358 7:4960150-4960172 GGAGTGGGAAGTGGAGGAGTTGG + Intergenic
1020957954 7:14766332-14766354 GGAGGTGTTAGTGGTGGAGTAGG + Intronic
1021924465 7:25521272-25521294 GGTGGGGCAAGTGGTTTTGTGGG + Intergenic
1022250996 7:28608314-28608336 GTAGGGGTGAGGGGTGTAATAGG + Intronic
1024044849 7:45579467-45579489 GGAGGGGTCCGTGGGGGAGTAGG - Intronic
1024302625 7:47899439-47899461 GGAGGAGTAAGGGGTGTGGATGG - Intronic
1029582851 7:101448792-101448814 GGAGGGGTCAGTTTTGTATTTGG + Intronic
1031145695 7:117994924-117994946 GGAGGAAAAAGTGGTTTAGTGGG + Intergenic
1041080380 8:54209785-54209807 GGAGGGGTCAGTGTTGTCATTGG + Intergenic
1042351697 8:67783638-67783660 GGAGGGCTTAGTGGAGTTGTGGG + Intergenic
1042872890 8:73414112-73414134 GGTGGTGAAAGTGGTGTGGTAGG + Intergenic
1043623736 8:82229583-82229605 GGAGGGAAAAGTGGTTTTGTGGG + Intergenic
1044602827 8:94022792-94022814 GGAGGGGTGGTGGGTGTAGTTGG + Intergenic
1045092978 8:98766227-98766249 TGAGGGGTCAGTAGTGTAGTTGG - Intronic
1045236436 8:100356468-100356490 GGAGGGTTAAGGAGGGTAGTGGG + Intronic
1045402065 8:101828951-101828973 GGATGGGTGAGTGGGGTGGTGGG + Intronic
1058617623 9:106850223-106850245 GGAGGGGGAAGAGGAGAAGTTGG - Intergenic
1058642333 9:107099735-107099757 GGTGGGGCAAGTGGTGGAGGAGG - Intergenic
1058660962 9:107268391-107268413 GGAGGGGAAAGAGGAGGAGTTGG - Intergenic
1059331049 9:113536073-113536095 GGAGGGGTTTGTAGTTTAGTTGG + Intronic
1061344203 9:130009076-130009098 GGAGGGGGCAGTGGTAGAGTGGG + Intronic
1061855584 9:133440392-133440414 GGAGGGGTAGGTGGTGTTAGGGG - Exonic
1062037596 9:134389621-134389643 GGAGGGGACAGTGGTGGAGAGGG + Intronic
1062481338 9:136753930-136753952 GGAGGAGAAAGTGATGCAGTCGG + Intergenic
1187120908 X:16405272-16405294 GGAGGGGAAAGTGGTGAAAGGGG - Intergenic
1192309393 X:69997682-69997704 GGAGGGAAAAGTGGTTTCGTGGG + Intronic
1194655107 X:96563570-96563592 GGAGGGAAAAGTGGAGGAGTAGG + Intergenic
1194765408 X:97842632-97842654 GGAGAGGAAGGTGGTGTAGGAGG - Intergenic
1196866793 X:120077821-120077843 GGAGGGGTAAGTGGTGTAGTAGG + Intergenic
1196876306 X:120158460-120158482 GGAGGGGTAAGTGGTGTAGTAGG - Intergenic
1197263794 X:124345001-124345023 AAAGGGGTAAGAGGTGGAGTTGG + Intronic
1197511152 X:127371058-127371080 GGAGGGAAAAGTGGTTTGGTGGG - Intergenic
1197596301 X:128468319-128468341 GGAGGGGTTAGGGGCATAGTGGG - Intergenic
1197795773 X:130296814-130296836 GGAGGGGTATGTGGATAAGTAGG - Intergenic
1200128154 X:153827826-153827848 GAAAGGGTAAGTTGTGCAGTAGG + Intronic
1200236956 X:154472399-154472421 GGAGGAGAAAGTGCTGTCGTCGG + Intronic