ID: 1196876308

View in Genome Browser
Species Human (GRCh38)
Location X:120158476-120158498
Sequence TTGGTGGTGTGGGGGGGGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 3936
Summary {0: 2, 1: 1, 2: 13, 3: 273, 4: 3647}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196876308_1196876322 4 Left 1196876308 X:120158476-120158498 CCCCTCCCCCCCCACACCACCAA 0: 2
1: 1
2: 13
3: 273
4: 3647
Right 1196876322 X:120158503-120158525 TGCTCTCCCTCATCCGGGCAAGG 0: 2
1: 0
2: 0
3: 11
4: 118
1196876308_1196876321 -1 Left 1196876308 X:120158476-120158498 CCCCTCCCCCCCCACACCACCAA 0: 2
1: 1
2: 13
3: 273
4: 3647
Right 1196876321 X:120158498-120158520 ACGCGTGCTCTCCCTCATCCGGG 0: 2
1: 0
2: 0
3: 4
4: 84
1196876308_1196876320 -2 Left 1196876308 X:120158476-120158498 CCCCTCCCCCCCCACACCACCAA 0: 2
1: 1
2: 13
3: 273
4: 3647
Right 1196876320 X:120158497-120158519 AACGCGTGCTCTCCCTCATCCGG 0: 2
1: 0
2: 0
3: 0
4: 47

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196876308 Original CRISPR TTGGTGGTGTGGGGGGGGAG GGG (reversed) Intergenic
Too many off-targets to display for this crispr