ID: 1196876311

View in Genome Browser
Species Human (GRCh38)
Location X:120158481-120158503
Sequence ACGCGTTGGTGGTGTGGGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 251
Summary {0: 2, 1: 0, 2: 0, 3: 13, 4: 236}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196876311_1196876320 -7 Left 1196876311 X:120158481-120158503 CCCCCCCCACACCACCAACGCGT 0: 2
1: 0
2: 0
3: 13
4: 236
Right 1196876320 X:120158497-120158519 AACGCGTGCTCTCCCTCATCCGG 0: 2
1: 0
2: 0
3: 0
4: 47
1196876311_1196876321 -6 Left 1196876311 X:120158481-120158503 CCCCCCCCACACCACCAACGCGT 0: 2
1: 0
2: 0
3: 13
4: 236
Right 1196876321 X:120158498-120158520 ACGCGTGCTCTCCCTCATCCGGG 0: 2
1: 0
2: 0
3: 4
4: 84
1196876311_1196876322 -1 Left 1196876311 X:120158481-120158503 CCCCCCCCACACCACCAACGCGT 0: 2
1: 0
2: 0
3: 13
4: 236
Right 1196876322 X:120158503-120158525 TGCTCTCCCTCATCCGGGCAAGG 0: 2
1: 0
2: 0
3: 11
4: 118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196876311 Original CRISPR ACGCGTTGGTGGTGTGGGGG GGG (reversed) Intergenic
900680788 1:3915123-3915145 ACGCGTGTGAGGTTTGGGGGAGG + Intergenic
901144627 1:7056716-7056738 ATGAGTTGGTGGTGGGGGGTGGG + Intronic
901633193 1:10657787-10657809 AGGCGGTGGGGGGGTGGGGGCGG + Intronic
901685875 1:10943057-10943079 ACGAGGTGGGGGTGGGGGGGTGG + Intergenic
901856500 1:12047724-12047746 ACGCATTGGTGCTCTGGGGGTGG - Intergenic
902079611 1:13812141-13812163 ATGGATTGGTGGTGGGGGGGAGG + Intronic
902809873 1:18882021-18882043 ACGCCTTGGAGGAGTGGGGTCGG - Intronic
903012595 1:20342299-20342321 AAGAGCTGGTGGGGTGGGGGTGG + Intronic
903703487 1:25267914-25267936 ACGCGTTGTTGTGGTGGGCGTGG + Intronic
903712754 1:25338243-25338265 ACGCGTTGTTGTGGTGGGCGTGG + Exonic
904831202 1:33307653-33307675 ACGGTTGGGTGGTGTGGGGTGGG - Intronic
906491793 1:46274231-46274253 CTGCATTGGTGGTGTGGGGACGG - Intronic
908411783 1:63873376-63873398 ACGGGTTGGAGGAGTGGGGTGGG - Intronic
909038427 1:70622181-70622203 ATGCGGTGGTGGTGGGGGGAGGG - Intergenic
912185518 1:107270712-107270734 GCGGGTTGGGGGTGGGGGGGCGG - Intronic
912411429 1:109483385-109483407 ACACAGGGGTGGTGTGGGGGAGG - Intergenic
913452205 1:119000053-119000075 TTGCGGTGGTGGGGTGGGGGTGG + Intergenic
915556175 1:156662001-156662023 GGGAGTTGGGGGTGTGGGGGAGG - Intergenic
915974348 1:160375189-160375211 ACTCGTGGGTGGTGGGGTGGGGG + Intergenic
916830425 1:168485376-168485398 CTGGGTTGGTGGGGTGGGGGTGG + Intergenic
916899200 1:169202341-169202363 AGGAGTTGGTGGTGGGGAGGGGG - Intronic
920400344 1:205672228-205672250 AGGCGCTGGTGTGGTGGGGGAGG - Intronic
920432777 1:205929311-205929333 AGGCGATGTTGGTGTGGGGGAGG + Exonic
921185659 1:212667378-212667400 AAGTGTTGGAGGTGTGAGGGTGG + Intergenic
921290326 1:213650974-213650996 ACGTGTTGGGGGTGGGGTGGAGG + Intergenic
921319515 1:213924984-213925006 AAGGGTTGGTGGGGTGGGTGGGG - Intergenic
923015035 1:230120152-230120174 ATGCGTTGGGGGTGGGGGTGGGG + Intronic
1063189173 10:3678171-3678193 ACAAGTTGGGGATGTGGGGGTGG - Intergenic
1064646436 10:17464685-17464707 AAGTGGTGGTGGTGTGGTGGTGG - Intergenic
1067064116 10:43094085-43094107 AAGCGGTGGGGGGGTGGGGGTGG + Intronic
1073046591 10:100642705-100642727 ACACGGTGGTGGGATGGGGGTGG + Intergenic
1076916186 10:133424039-133424061 ACGCGTTGCTGGGATGTGGGGGG + Intronic
1076936294 10:133568834-133568856 ACGCGTTGCTGGGATGTGGGGGG + Intronic
1077075116 11:697000-697022 ACCCGGTGGTGGTGGTGGGGGGG + Intronic
1077334246 11:1996455-1996477 ACGTGTTGGTTGTGTGGGGAGGG + Intergenic
1079184377 11:18222857-18222879 ATGTGTGTGTGGTGTGGGGGGGG + Intronic
1079784492 11:24654627-24654649 AGGGGTGGGTGGGGTGGGGGTGG - Intronic
1080427696 11:32171440-32171462 AGGGGTTGGTGGTGAGGGAGTGG + Intergenic
1081579949 11:44345338-44345360 GCTCTTTGGTGGTGTGGGGAGGG + Intergenic
1081886242 11:46499278-46499300 ACGCAGTGGGGGTTTGGGGGAGG - Intronic
1083586523 11:63863761-63863783 AAGTGGTGGTGGTGTGGGGCGGG - Intronic
1083780516 11:64915135-64915157 TGGGGTTGGTGGTGGGGGGGGGG - Intronic
1083822502 11:65181282-65181304 ACGCGGCGGTGGGGTGGGGAAGG + Exonic
1089298221 11:117482121-117482143 TGGCGATGGTGGTGTTGGGGTGG + Exonic
1090327546 11:125902364-125902386 ACGGGGTGGTGGCGGGGGGGAGG + Intronic
1202817229 11_KI270721v1_random:51637-51659 ACGTGTTGGTTGTGTGGGGAGGG + Intergenic
1091584978 12:1810973-1810995 CCTCGTTGCTGGTGTGGGGAGGG + Intronic
1092327625 12:7549928-7549950 AGGGGTTGGGGGTCTGGGGGAGG + Intergenic
1092461042 12:8686404-8686426 ACGCGTCTGTGGTGGGGAGGCGG - Intronic
1094049960 12:26208006-26208028 AAGTGGTGGTGGTGGGGGGGGGG + Intronic
1096109503 12:49020608-49020630 AAGGGGTGGTGATGTGGGGGTGG - Exonic
1098297521 12:69018757-69018779 ACGTGTTGTTGGAGAGGGGGTGG + Intergenic
1099956013 12:89353363-89353385 AGGCGATGGTGGTGGTGGGGCGG - Intergenic
1101157807 12:101944093-101944115 AAGGGAAGGTGGTGTGGGGGAGG + Intronic
1101940078 12:109093372-109093394 ACACGTCCGTGGGGTGGGGGTGG + Exonic
1102505374 12:113381246-113381268 AAGCGGTGGGGATGTGGGGGGGG - Intronic
1102591310 12:113958740-113958762 AGGGGTTTGTGGTGTGGGGGAGG - Intronic
1102907624 12:116688854-116688876 AGGCGGTGGTGGGGTGGGGTGGG + Intergenic
1102955980 12:117059258-117059280 ACGCATTGGAGGGGTGGGGATGG + Intronic
1104932524 12:132347373-132347395 ATGCTGTGGTGGTGTCGGGGTGG + Intergenic
1105295828 13:19087444-19087466 GTGTGTTGGTGGGGTGGGGGTGG - Intergenic
1108518140 13:51222040-51222062 CCGCGTGTGTGTTGTGGGGGCGG - Intergenic
1112226305 13:97543997-97544019 ATGGGGTGGTGGGGTGGGGGTGG - Intergenic
1114450469 14:22822173-22822195 AAGCGAGGGTGGTGGGGGGGTGG - Intronic
1115399514 14:32940359-32940381 CCACGTTGGTGGTGATGGGGAGG - Intronic
1116958440 14:50946255-50946277 ACATGGTGGTGGTGGGGGGGGGG + Intergenic
1117068464 14:52034013-52034035 ACCCAATGGTGGGGTGGGGGTGG - Intronic
1120258266 14:82147950-82147972 ACGGGTTGGGGGTATAGGGGAGG - Intergenic
1122186879 14:100006016-100006038 AAGTGTTGTCGGTGTGGGGGGGG - Intronic
1122281826 14:100628051-100628073 ACGGGGTGGTGGGGTGGGTGGGG + Intergenic
1122446871 14:101776025-101776047 AGGCGGGGGTGGAGTGGGGGGGG - Intronic
1122585839 14:102806005-102806027 TGGAGTTGGTGGGGTGGGGGTGG + Intronic
1125169498 15:36750087-36750109 TCGCGGTGGTGGTGTGGTGGGGG + Intronic
1127890126 15:63242858-63242880 AGGTGGTGGTGGTGTGGGGGTGG + Intronic
1128081435 15:64859535-64859557 ACTCATGGGTGGTGTGGGGTGGG + Intronic
1128880527 15:71238046-71238068 ACTTTATGGTGGTGTGGGGGCGG + Intronic
1131729999 15:95269436-95269458 ACTCGGTGGGGGTGTGGGGATGG + Intergenic
1132552863 16:560534-560556 ACGCGCTGGGGCTCTGGGGGTGG - Exonic
1136749798 16:32624135-32624157 ATCAGTTGGTGGGGTGGGGGGGG - Intergenic
1137403084 16:48169318-48169340 ATGCATTTGTGGTGTGGGTGAGG - Intronic
1138440887 16:57034323-57034345 TTGGGTGGGTGGTGTGGGGGAGG + Intronic
1138445444 16:57060353-57060375 GCGTGTGTGTGGTGTGGGGGAGG - Intronic
1139518703 16:67467171-67467193 AGGCTTTGGGGGTGTGGGGGAGG - Intronic
1141788757 16:86218766-86218788 ACGGGTAGGTGGGGTGGGGTGGG - Intergenic
1142290871 16:89193116-89193138 ATGAGTGGGTGGTGTTGGGGAGG - Intronic
1203051932 16_KI270728v1_random:883333-883355 ATCAGTTGGTGGGGTGGGGGGGG - Intergenic
1142709263 17:1714772-1714794 ATGCGTTGGAACTGTGGGGGCGG - Intergenic
1146580028 17:34029076-34029098 ACTAATTGGTGTTGTGGGGGAGG - Intronic
1148560324 17:48602370-48602392 GCGCCTTGGTGGGGTGGGGGTGG + Intronic
1148797068 17:50202017-50202039 AAGGGTTGGGGGTGTTGGGGAGG + Intergenic
1148829604 17:50422761-50422783 AGGGGTTGGGGGTGTGGTGGGGG - Intergenic
1152376090 17:79919758-79919780 AGACGTTGGTGGGGTGGGGTGGG + Intergenic
1152755142 17:82084081-82084103 ACGCGCTGGTGGTGCGTGGGCGG - Exonic
1152874904 17:82781120-82781142 ACGCATGGCAGGTGTGGGGGAGG + Intronic
1157376907 18:47175755-47175777 AAGAGTTGGGGGTGTGGGGCCGG - Intronic
1160025518 18:75212081-75212103 CCAGGTTGGGGGTGTGGGGGAGG - Intronic
1160349037 18:78159148-78159170 AGTCGTTGGTGGTGGTGGGGCGG - Intergenic
1162725917 19:12689682-12689704 AGCCCCTGGTGGTGTGGGGGAGG - Intronic
1165373866 19:35427736-35427758 CCTCGGTGGTGGTGTGGGAGGGG - Intergenic
1165466631 19:35978681-35978703 AAGGGTTGGTGGTGAGGGAGGGG - Intergenic
1165601051 19:37056184-37056206 AGGCGTTGGAGGGGTGGGGATGG + Intronic
1168105265 19:54162377-54162399 GCGTATTGGTGGTGGGGGGGGGG + Intronic
1168289046 19:55348038-55348060 ACCCCTTTCTGGTGTGGGGGAGG - Exonic
925123621 2:1438195-1438217 TGGCGTTGGAGATGTGGGGGCGG + Intronic
929558122 2:42938045-42938067 ACCTGTTGGTGGCGTGGGAGTGG - Intergenic
929787851 2:45004926-45004948 GCGCGTCGCTGGTGTGGGGAGGG + Intergenic
932495616 2:72144530-72144552 GCGGGGTGGGGGTGTGGGGGTGG - Intronic
932532747 2:72554897-72554919 AGGGGTTGGGGGTCTGGGGGAGG - Intronic
932883572 2:75527188-75527210 AGGCTTTGCTGGTGTGGGTGTGG - Intronic
935689926 2:105721815-105721837 CCTTGTTGGAGGTGTGGGGGTGG - Intergenic
937084683 2:119163130-119163152 ATGTGGTGGTGGAGTGGGGGTGG + Intergenic
938405674 2:131031925-131031947 ACACGGTGGTGGTGGTGGGGAGG - Intronic
940056733 2:149521242-149521264 TGGAGTTGGTGGTGTGGTGGTGG - Intergenic
941752102 2:169144388-169144410 AAGTGCTGGTGGAGTGGGGGTGG - Intronic
944917771 2:204378449-204378471 GCGGGTTGGGGGTATGGGGGTGG - Intergenic
945735392 2:213592982-213593004 TGGTGTTGGTGGGGTGGGGGTGG - Intronic
946345955 2:219110604-219110626 AAGTGCTGGTGGGGTGGGGGTGG + Intronic
947251884 2:228115820-228115842 ATGAGTTGGTGGGGTGGGTGGGG - Intronic
948517705 2:238514571-238514593 AAGTGTTGGGGGTGGGGGGGGGG - Intergenic
1169404921 20:5315170-5315192 AGGTGGTGGTGGGGTGGGGGAGG + Intergenic
1171264364 20:23758823-23758845 ATGGGGTGGGGGTGTGGGGGAGG + Intergenic
1172290002 20:33769363-33769385 AAGGGGTGGTGGTGGGGGGGGGG + Intronic
1172702540 20:36862358-36862380 AGGCGTTGCTGAGGTGGGGGTGG - Intronic
1173454673 20:43192437-43192459 AGGAGATGGGGGTGTGGGGGTGG + Intergenic
1174336120 20:49862077-49862099 ACGCAGCGGTGGGGTGGGGGTGG - Intronic
1174387924 20:50198031-50198053 ATGCATGGGTGGAGTGGGGGAGG + Intergenic
1175088572 20:56482869-56482891 ATGGGTGTGTGGTGTGGGGGAGG - Intronic
1175176911 20:57117864-57117886 GCGCTTTGGTGGGGTGGGGTGGG - Intergenic
1175228523 20:57459488-57459510 AAGCTGTGGTGGTGGGGGGGGGG + Intergenic
1175406944 20:58741160-58741182 GCGGGTGGGTGGCGTGGGGGTGG - Intergenic
1176031576 20:63015529-63015551 ACTGGTGGGTGGTGTGGGAGAGG + Intergenic
1176054581 20:63137332-63137354 AGGGGTTGGGGGTGTGGTGGGGG - Intergenic
1177284828 21:19036546-19036568 AAGTGGTGGTGGTGTGGGGATGG + Intergenic
1177638890 21:23820881-23820903 ACCCCTGGGTGGTGTGGTGGGGG - Intergenic
1178310271 21:31524403-31524425 AGGTGTTTGTGTTGTGGGGGCGG - Intronic
1181111950 22:20607427-20607449 GCGGGCTGGTGGTGTGGGAGTGG + Intergenic
1181276167 22:21688575-21688597 AGGAGTTGGTGGCGTGGGGCTGG + Intronic
1182357650 22:29729612-29729634 AGGCGGCGGTGGTGTGGGGCGGG - Exonic
1182548118 22:31087147-31087169 ACATGGTGGAGGTGTGGGGGAGG + Intronic
1182988478 22:34743610-34743632 ATGAGCTGGTGGTTTGGGGGAGG - Intergenic
1183279425 22:36924108-36924130 AGGCGGTGGAGGGGTGGGGGTGG - Intronic
1183704610 22:39469103-39469125 CTGCCTTGGTGGTGTGGGGAGGG + Intronic
1183990500 22:41594352-41594374 AGGCGGTGGGGGGGTGGGGGAGG + Intergenic
1183990512 22:41594372-41594394 AGGCGGTGGGGGGGTGGGGGTGG + Intergenic
1184050309 22:41999086-41999108 GCGCGTTTGAGGGGTGGGGGTGG + Intronic
1184386133 22:44175672-44175694 AGGCGTTGGGTGTGGGGGGGTGG + Intronic
1184555150 22:45228996-45229018 AGTGTTTGGTGGTGTGGGGGTGG - Intronic
1185341816 22:50294385-50294407 GAGCGTTGGGGGTGTGGTGGGGG - Intronic
950263724 3:11560141-11560163 AAGCGGTGGTGGTGGGGCGGTGG - Intronic
951503855 3:23419360-23419382 ACACATTGAGGGTGTGGGGGTGG - Intronic
952162223 3:30705476-30705498 ACGCTTTGGTGGTGAGGGGTGGG - Intergenic
952257143 3:31705374-31705396 CCGCGATGGGGGTGGGGGGGGGG - Intronic
952441414 3:33333759-33333781 ATGGGTTGGTGGGGTGGGGAAGG - Intronic
952900634 3:38109570-38109592 CAGGGTTGGTGGTCTGGGGGTGG + Intronic
952955050 3:38551625-38551647 AGGGGTTGGCGGTGGGGGGGGGG + Intronic
953929970 3:47000970-47000992 ACAGGTGGGTGGTGTGGGCGTGG - Intronic
956652822 3:71521100-71521122 AAGGCTAGGTGGTGTGGGGGAGG + Intronic
959170311 3:102836391-102836413 GCGTGGTGGTGGTTTGGGGGAGG - Intergenic
962106105 3:132391350-132391372 ACACTTTGTTGGGGTGGGGGTGG + Intergenic
966974806 3:185074330-185074352 AGGCAGGGGTGGTGTGGGGGTGG - Intergenic
967984786 3:195086715-195086737 ATGCTTTGGTGATGGGGGGGAGG + Intronic
969697703 4:8744497-8744519 ACGCGTGAAGGGTGTGGGGGAGG + Intergenic
969713784 4:8858907-8858929 ACGCGGTGGTGGTGGTGGTGGGG + Intronic
970054118 4:11951542-11951564 AGGCAGTGGAGGTGTGGGGGAGG - Intergenic
974432527 4:61817150-61817172 ATGCCTTGGTGGGGGGGGGGGGG - Intronic
977957371 4:103045605-103045627 ACACGTAGTTGGTGGGGGGGTGG + Intronic
978253467 4:106662177-106662199 TTGCATTGGTGGAGTGGGGGTGG - Intergenic
978325991 4:107555926-107555948 ATGGGTTGGTGGGGTAGGGGAGG - Intergenic
978466432 4:109013936-109013958 GGGGGTTGGTGGGGTGGGGGAGG - Intronic
983515884 4:168656242-168656264 AAGCGTTGGGGGTGGGGGGTGGG - Intronic
984603101 4:181751786-181751808 ACGCATTGTTTGTGTTGGGGTGG + Intergenic
984771014 4:183436307-183436329 ACGCGGCGGTGGGGTGGGGCGGG + Intergenic
987070134 5:14328866-14328888 ACGTGTGGGAGGTGTGGGGTGGG - Intronic
991927288 5:71718343-71718365 AAGGGTTGGTGGTGGGTGGGGGG + Intergenic
995141421 5:108739626-108739648 AGCCCTTGGTGGTGTTGGGGTGG - Intergenic
995433029 5:112103542-112103564 AGTGGTTGGTGGGGTGGGGGCGG + Intergenic
996704061 5:126478826-126478848 AGGAGTTCCTGGTGTGGGGGTGG + Intronic
998129348 5:139643505-139643527 AGGGTGTGGTGGTGTGGGGGAGG - Intergenic
998166921 5:139849463-139849485 AGGAGCTGGTGGTGTGGGGATGG - Intronic
998848810 5:146335668-146335690 ATGCCATGGTGGTGGGGGGGGGG + Intronic
999621265 5:153476799-153476821 AGGCATTGGAGCTGTGGGGGTGG - Intergenic
1001032606 5:168273631-168273653 GCAGGTTGGTGGTGCGGGGGTGG + Intergenic
1002064632 5:176645964-176645986 ACAAGTTTGTGGTGTGAGGGGGG + Exonic
1002431125 5:179204590-179204612 ACCCTTTGGTGGTCTTGGGGAGG - Intronic
1002977516 6:2097356-2097378 AGGAGATGGTGGTGCGGGGGTGG + Intronic
1003179131 6:3777279-3777301 ACCTGGTGGTGGTGTGGAGGAGG + Intergenic
1010119953 6:72363896-72363918 ACTTGGTGGTAGTGTGGGGGAGG + Intronic
1010615622 6:78008765-78008787 AGGAATTGGTGGGGTGGGGGTGG - Intergenic
1017087776 6:150730327-150730349 AGGTGGTGGGGGTGTGGGGGTGG + Intronic
1017834844 6:158168106-158168128 AGGCAGGGGTGGTGTGGGGGCGG - Intronic
1017842629 6:158233417-158233439 ACCCGTTGCAGGTGTGGGTGTGG + Intronic
1018580800 6:165307211-165307233 TGGGGTTGGTGGGGTGGGGGGGG - Intronic
1018964681 6:168475430-168475452 ACGACCTGGTGGGGTGGGGGAGG - Intronic
1023153699 7:37226525-37226547 ATGGTTTGGTGGGGTGGGGGAGG - Intronic
1024136592 7:46415071-46415093 TCCCTTTGGTGGGGTGGGGGTGG - Intergenic
1024306930 7:47937247-47937269 ACGGGGTGGGGGTGGGGGGGGGG + Intronic
1026740702 7:72976583-72976605 CGGGGTTGGGGGTGTGGGGGTGG - Intergenic
1026955291 7:74372891-74372913 ACACGGTGGGGGGGTGGGGGCGG - Intronic
1027103030 7:75388488-75388510 CGGGGTTGGGGGTGTGGGGGTGG + Intergenic
1028023281 7:85805458-85805480 ACGCACTGGTGGAGTGGGGCAGG - Intergenic
1030614443 7:111724078-111724100 ATATGTTGGTGGGGTGGGGGGGG - Intergenic
1030687627 7:112503253-112503275 AGGTGTTGATGGTGTGCGGGAGG + Intergenic
1034563011 7:151893816-151893838 CAGCCTTGGTGGTGTGGAGGTGG - Intergenic
1034868372 7:154660062-154660084 ACGTGTTGGTGGTGAGGGAAGGG + Intronic
1034965741 7:155389478-155389500 ACGCGCTGGGGTTGGGGGGGCGG + Intronic
1036912098 8:12766032-12766054 CCGCGTTGTGGGTGTGGGGAAGG + Intergenic
1036932923 8:12973636-12973658 ACATGTTGGAGGTGTAGGGGTGG + Intronic
1038706622 8:29899980-29900002 ACGGGGTGGGGGTGTGGGGATGG - Intergenic
1039906533 8:41790556-41790578 ATGAATTGGTGGGGTGGGGGTGG - Intronic
1040903235 8:52438849-52438871 ACGCGTGGAGTGTGTGGGGGAGG + Intronic
1041968261 8:63705739-63705761 AAGTGCTGGGGGTGTGGGGGAGG + Intergenic
1042881185 8:73492042-73492064 ACTTCTTGGTGGTGTGGGGAAGG - Intronic
1043107307 8:76130857-76130879 ACTGTTTGGTGGGGTGGGGGGGG - Intergenic
1043397728 8:79855147-79855169 AGGGGTTGGTGGGGTGGGGGTGG - Intergenic
1043754360 8:83984497-83984519 TCGTGGTGGTGGTGTGGTGGTGG - Intergenic
1047640162 8:126810629-126810651 ATGGGATGGTGGGGTGGGGGTGG - Intergenic
1047998219 8:130357203-130357225 AAGCGTTGCTGGTGGGGGGTGGG - Intronic
1048348531 8:133596958-133596980 ACGGGGTGGTGGGGTTGGGGAGG - Intergenic
1049168334 8:141141077-141141099 ACGCGTTGCAGGGGTGGGGATGG + Intronic
1049380909 8:142315348-142315370 TCGCGGAGGTGGTGTGGGGCCGG - Intronic
1049952381 9:657880-657902 TGGTGGTGGTGGTGTGGGGGTGG + Intronic
1050835121 9:10067773-10067795 ACTCGTTTGTGCTGTTGGGGTGG - Intronic
1052882190 9:33608443-33608465 AGGGGGTGGTGGTTTGGGGGTGG - Intergenic
1053943691 9:43280517-43280539 CCGCGGTGTTGGGGTGGGGGGGG + Intergenic
1054308516 9:63449479-63449501 CCGCGTCGGCGGTGGGGGGGGGG + Intergenic
1055071082 9:72166409-72166431 ATGTGTGGGTGGGGTGGGGGTGG + Intronic
1057152054 9:92804990-92805012 ATGCGTGTGTGGTGTGGGTGTGG + Intergenic
1059941247 9:119362045-119362067 AGGGGTTGGGGGTGGGGGGGTGG - Intronic
1062463356 9:136671018-136671040 AGGCATTGGTGGGGGGGGGGGGG + Intronic
1062517332 9:136943250-136943272 ACCAGGTGGTGGTGGGGGGGGGG - Intronic
1062524217 9:136971789-136971811 AGGCCTTGGGGGTGTGGGGTAGG + Exonic
1203586809 Un_KI270747v1:10420-10442 CCGCGGTGTTGGGGTGGGGGGGG + Intergenic
1186874441 X:13803301-13803323 ACGGGGTTGTGGGGTGGGGGCGG - Intronic
1187133444 X:16525064-16525086 TCGCATGGCTGGTGTGGGGGTGG + Intergenic
1187486769 X:19711588-19711610 AAGAGGTGGTGGGGTGGGGGTGG - Intronic
1189937484 X:46084814-46084836 AGGAGTTGGGGGTGTAGGGGGGG - Intergenic
1190094366 X:47467029-47467051 AAGGGTTGGTGCTGTGGTGGGGG + Intronic
1190267435 X:48835655-48835677 TCGGGTGGGTGGGGTGGGGGCGG - Intergenic
1192923941 X:75736222-75736244 ACCCAGTGGTGGGGTGGGGGAGG - Intergenic
1192996960 X:76521962-76521984 AGGGGTTGGGGGTCTGGGGGAGG - Intergenic
1194206544 X:91018127-91018149 AAGGGTTGGTGGGGGGGGGGGGG - Intergenic
1194866699 X:99077888-99077910 ACGGGGTGGGGGTATGGGGGAGG - Intergenic
1196728282 X:118916918-118916940 GCGTGTTGGTGGTGGGTGGGAGG - Intergenic
1196866788 X:120077800-120077822 ACGCGTTGGTGGTGTGGGGGGGG + Intergenic
1196876311 X:120158481-120158503 ACGCGTTGGTGGTGTGGGGGGGG - Intergenic
1198808233 X:140509551-140509573 ACGCGTTGGCGGAGTGGGGCTGG - Intergenic
1200780403 Y:7210363-7210385 TAGTGTTGGTGGTGTGGTGGTGG + Intergenic
1202273613 Y:23094291-23094313 ACACACTGGTGGTGTGTGGGTGG + Intergenic
1202292413 Y:23326390-23326412 ACACACTGGTGGTGTGTGGGTGG - Intergenic
1202426610 Y:24728036-24728058 ACACACTGGTGGTGTGTGGGTGG + Intergenic
1202444179 Y:24942050-24942072 ACACACTGGTGGTGTGTGGGTGG - Intergenic