ID: 1196876313

View in Genome Browser
Species Human (GRCh38)
Location X:120158483-120158505
Sequence GCACGCGTTGGTGGTGTGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 2, 1: 0, 2: 2, 3: 8, 4: 138}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196876313_1196876322 -3 Left 1196876313 X:120158483-120158505 CCCCCCACACCACCAACGCGTGC 0: 2
1: 0
2: 2
3: 8
4: 138
Right 1196876322 X:120158503-120158525 TGCTCTCCCTCATCCGGGCAAGG 0: 2
1: 0
2: 0
3: 11
4: 118
1196876313_1196876321 -8 Left 1196876313 X:120158483-120158505 CCCCCCACACCACCAACGCGTGC 0: 2
1: 0
2: 2
3: 8
4: 138
Right 1196876321 X:120158498-120158520 ACGCGTGCTCTCCCTCATCCGGG 0: 2
1: 0
2: 0
3: 4
4: 84
1196876313_1196876330 29 Left 1196876313 X:120158483-120158505 CCCCCCACACCACCAACGCGTGC 0: 2
1: 0
2: 2
3: 8
4: 138
Right 1196876330 X:120158535-120158557 TGACGCATGCGCACCTCAGCAGG 0: 2
1: 2
2: 0
3: 3
4: 25
1196876313_1196876320 -9 Left 1196876313 X:120158483-120158505 CCCCCCACACCACCAACGCGTGC 0: 2
1: 0
2: 2
3: 8
4: 138
Right 1196876320 X:120158497-120158519 AACGCGTGCTCTCCCTCATCCGG 0: 2
1: 0
2: 0
3: 0
4: 47

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196876313 Original CRISPR GCACGCGTTGGTGGTGTGGG GGG (reversed) Intergenic
900948141 1:5842872-5842894 GCAGGCTTTGGGGGTGCGGGAGG + Intergenic
901653246 1:10755108-10755130 GCAAGCGGCAGTGGTGTGGGTGG + Intronic
902814482 1:18908376-18908398 GCACCCGTTGGTGGTGTGGAAGG + Exonic
903577539 1:24348005-24348027 CCACTCTCTGGTGGTGTGGGGGG - Intronic
905226162 1:36480573-36480595 GCACGAGTTGGTGCTCTTGGTGG + Intronic
911349893 1:96740364-96740386 GCACACTTTGGGGGAGTGGGTGG + Intronic
913518985 1:119628050-119628072 GCAGGCGTTGGCGGGGCGGGGGG + Intronic
914096208 1:144546333-144546355 GCAGGCCTTGGTGGGGGGGGAGG + Intergenic
917190123 1:172407779-172407801 GGACGAGTTGGTGATGGGGGTGG - Exonic
921696187 1:218214051-218214073 GCACAGGATGGTGGTGTGGCAGG - Intergenic
923015033 1:230120150-230120172 GCATGCGTTGGGGGTGGGGGTGG + Intronic
923471011 1:234291121-234291143 GGAGGGGTTGGTGGTTTGGGGGG - Intronic
924050119 1:240071994-240072016 GGACTGGTTGGTGGTATGGGTGG + Intronic
1062833431 10:621311-621333 GCACACCTTGGGGGTGTGTGTGG - Intronic
1065486986 10:26245213-26245235 GCTGGGGTTGGGGGTGTGGGGGG + Intronic
1066231393 10:33438091-33438113 GCAAGGGTTGGGGGTGGGGGTGG + Intergenic
1067523088 10:47022560-47022582 GCCAGCGTTGTTGGGGTGGGAGG + Intergenic
1069757424 10:70781813-70781835 TCACGTGCTGGGGGTGTGGGTGG + Exonic
1070768078 10:79067855-79067877 GGGCGCGTTTGTGGTTTGGGGGG + Intergenic
1071026701 10:81122891-81122913 GAGCAAGTTGGTGGTGTGGGTGG - Intergenic
1072465094 10:95656198-95656220 GCACTGGTGGGTGGCGTGGGTGG - Intronic
1075321588 10:121495622-121495644 GCAGGCCTTGGTGGTGTGACTGG + Intronic
1076916184 10:133424037-133424059 GCACGCGTTGCTGGGATGTGGGG + Intronic
1076936292 10:133568832-133568854 GCACGCGTTGCTGGGATGTGGGG + Intronic
1081346371 11:41991992-41992014 GCACGTTTTGGGGATGTGGGAGG - Intergenic
1081726859 11:45336210-45336232 CCAGGCATTGGTGGTGTGAGGGG + Intergenic
1083691117 11:64409536-64409558 GCACCCGGAGGTGGTGGGGGCGG - Intergenic
1083972365 11:66087129-66087151 GCTATCGTTGGTGGAGTGGGAGG - Intronic
1084000302 11:66292245-66292267 GCCCGCGTTGGGGGTAGGGGTGG + Intronic
1084126729 11:67103954-67103976 GCACACGTTGGATGTGCGGGAGG - Intergenic
1084319199 11:68364041-68364063 GCGGGCGTGGGTGGGGTGGGGGG + Intronic
1084321013 11:68373375-68373397 GGATGCGTTGGTGGCGGGGGGGG + Intronic
1096434517 12:51577453-51577475 GCAGGGCTTGCTGGTGTGGGAGG + Intergenic
1099973821 12:89525854-89525876 GGACGGGTTGGAGGTGGGGGGGG - Intronic
1102601322 12:114032725-114032747 CAACGTGGTGGTGGTGTGGGGGG + Intergenic
1104623772 12:130337483-130337505 GCACGTGTTGGGTGTCTGGGCGG + Intergenic
1104720975 12:131045128-131045150 GCGCCCGCGGGTGGTGTGGGAGG - Intronic
1105918745 13:24941269-24941291 CCACCCGTTGGTGGTGGGTGGGG - Intergenic
1108903001 13:55435935-55435957 CCACACATTAGTGGTGTGGGGGG - Intergenic
1111784169 13:92766293-92766315 ACATGCAGTGGTGGTGTGGGTGG - Intronic
1113742079 13:112718118-112718140 TCACGCCTTGGCGGGGTGGGGGG - Intronic
1118825951 14:69381676-69381698 GCAGGGGTCGGTGGTGGGGGTGG - Intronic
1119031849 14:71198959-71198981 GCACACGTGAGTGGGGTGGGAGG - Intergenic
1122281824 14:100628049-100628071 ACACGGGGTGGTGGGGTGGGTGG + Intergenic
1125169496 15:36750085-36750107 GTTCGCGGTGGTGGTGTGGTGGG + Intronic
1129602761 15:77009868-77009890 GCAGGCGTAGGTGGTGTGGGAGG + Intronic
1130550915 15:84889394-84889416 GCAGGGGGTGGTGGTGGGGGAGG + Intronic
1130686368 15:86041224-86041246 GCAGGTGGGGGTGGTGTGGGGGG + Intergenic
1132410138 15:101571296-101571318 GCACGACTTTGGGGTGTGGGCGG + Intergenic
1132546271 16:534798-534820 GCCCGAGCTGGGGGTGTGGGGGG - Intronic
1132559022 16:584975-584997 GCACAGGTTGGGGGTGTTGGTGG - Intergenic
1132559042 16:585027-585049 GCACAGGTTGGGGGTGTTGGTGG - Intergenic
1132559062 16:585079-585101 GCACAGGTTGGGGGTGTTGGTGG - Intergenic
1132559082 16:585131-585153 GCACAGGTTGGGGGTGTTGGTGG - Intergenic
1132559102 16:585183-585205 GCACAGGTTGGGGGTGTTGGTGG - Intergenic
1132559122 16:585235-585257 GCACAGGTTGGGGGTGTTGGTGG - Intergenic
1132559142 16:585287-585309 GCACAGGTTGGGGGTGTTGGTGG - Intergenic
1140069257 16:71634915-71634937 GCCAGCGTTGGTGTGGTGGGCGG + Intronic
1140941073 16:79722562-79722584 GCTGGTGATGGTGGTGTGGGTGG + Intergenic
1141581498 16:85002711-85002733 GAAAGCGTGGGTGGAGTGGGGGG + Intronic
1142700842 17:1659637-1659659 GAACAAGTTGGTGGAGTGGGTGG - Intronic
1142848736 17:2694334-2694356 GCAAGCGTTGGTGGGTTGGGAGG - Intronic
1143575054 17:7787368-7787390 GCTCGCATTGTTGGAGTGGGTGG - Intronic
1145963423 17:28900910-28900932 GGAGGCGGTAGTGGTGTGGGGGG + Intronic
1147175670 17:38654788-38654810 GCAGGGTTTGGTGGTGTCGGCGG + Intergenic
1150462809 17:65366593-65366615 CCACGCTTCGCTGGTGTGGGTGG + Intergenic
1150672906 17:67217608-67217630 GCACGCGGTGGAGAGGTGGGAGG - Intronic
1151512384 17:74569190-74569212 GCATGTGTGGGGGGTGTGGGTGG + Intergenic
1152252716 17:79220077-79220099 GCACGGGGTGGGGGGGTGGGGGG + Intronic
1152738228 17:82007795-82007817 GCAGGCGCTGGGGCTGTGGGGGG + Intronic
1157926363 18:51771149-51771171 GACAGCATTGGTGGTGTGGGGGG + Intergenic
1164595792 19:29530057-29530079 GCCCGCGTTGTTGGCGTTGGCGG - Exonic
1165466633 19:35978683-35978705 GGAAGGGTTGGTGGTGAGGGAGG - Intergenic
1165767857 19:38362032-38362054 GAAGGCGTTGGGGGTGTGGCCGG + Intronic
1165886717 19:39084170-39084192 CCACGCCCTGGTGGGGTGGGCGG + Intronic
1167120372 19:47513122-47513144 GCAGGGGGCGGTGGTGTGGGAGG - Intronic
1167602077 19:50460089-50460111 GAACGCGCTGGTGGAGTGGCAGG + Exonic
1167762861 19:51460379-51460401 GCAAGCATTGGTGATGGGGGTGG - Intergenic
1168309150 19:55452003-55452025 GCCCGGGTTGGTGGGGTGGGGGG + Intergenic
925286868 2:2721665-2721687 GCAGGTGCTGGTGGTGTGGCCGG - Intergenic
928096180 2:28406583-28406605 GCACGCCTAGGTGGTGTGGTGGG - Intronic
929780846 2:44955859-44955881 GTGCACGTGGGTGGTGTGGGGGG + Intergenic
933983323 2:87571219-87571241 GCTGGCGTTGTTGGGGTGGGAGG + Intergenic
934699368 2:96427586-96427608 GCTGGGGCTGGTGGTGTGGGTGG - Intergenic
936086593 2:109473719-109473741 GCAGGAGTGGGTGGGGTGGGTGG - Intronic
936310525 2:111379575-111379597 GCTGGCGTTGTTGGGGTGGGAGG - Intergenic
937993316 2:127675653-127675675 GCACGCGTTTGCGGTTGGGGCGG - Intronic
947372102 2:229457607-229457629 GCCCTCTTTGGTGGTGGGGGTGG - Intronic
948813525 2:240498279-240498301 GCAGGTGTTGGGGGTGGGGGGGG + Intronic
1172904155 20:38356399-38356421 GCGCGTGTGTGTGGTGTGGGGGG - Intronic
1173167078 20:40692842-40692864 GCACGCATGGGTGCTGTTGGAGG + Intergenic
1173809959 20:45949565-45949587 GCACCTGTTGGTGGGGGGGGCGG + Exonic
1175521334 20:59604339-59604361 GCACGGCTTGGTGGGGTGGGCGG + Intronic
1175924587 20:62465588-62465610 GCAGGCGTGGGTGGTGTGGCCGG + Intronic
1176126425 20:63477392-63477414 GCACGGGGTGGTGGCCTGGGAGG - Intergenic
1177638892 21:23820883-23820905 GCACCCCTGGGTGGTGTGGTGGG - Intergenic
950882637 3:16335615-16335637 GGACCTGTTGGAGGTGTGGGAGG + Intronic
952955048 3:38551623-38551645 GCAGGGGTTGGCGGTGGGGGGGG + Intronic
953469808 3:43156996-43157018 GCACGTGTGGGTAGTGTGAGGGG + Intergenic
953901097 3:46844856-46844878 GGCGGCGTTGGTGGGGTGGGGGG - Intergenic
956257888 3:67303966-67303988 GCAAGGTTTGGTGGGGTGGGGGG + Intergenic
961430217 3:126876248-126876270 GCAGGTGTTACTGGTGTGGGTGG + Intronic
962318411 3:134372932-134372954 GCAGGGGTTGGGGGGGTGGGTGG + Intronic
967488331 3:190059632-190059654 GCAAGTGTTGGAGGGGTGGGTGG - Intronic
968614695 4:1572117-1572139 CCAGGCGTTGGTGGTGGGGCTGG - Intergenic
968807943 4:2787362-2787384 GCAGGGGGTGGTGGTGGGGGTGG + Intergenic
969713782 4:8858905-8858927 TCACGCGGTGGTGGTGGTGGTGG + Intronic
971246814 4:24936862-24936884 GCAAGCTTTTGTGGTGTTGGAGG + Intronic
972676063 4:41260463-41260485 GCTGGCGTGGGTGGTGTGGGAGG + Intronic
973118099 4:46486464-46486486 GCATGGGTCGGTGGGGTGGGGGG - Intergenic
977756900 4:100682535-100682557 GCACACGGTGGGGGTGTGGCAGG - Intronic
978028317 4:103906163-103906185 GCCCGGGTGGGTGGTGAGGGTGG - Intergenic
978045300 4:104118234-104118256 GCACGAGTTGGAGGTGGGGATGG - Intergenic
978290289 4:107130070-107130092 GTAGGAGTTGGTGGTGTTGGTGG - Intronic
979140127 4:117162294-117162316 GCACAGGTTGGGGGTGTGGCAGG - Intergenic
980299202 4:130965609-130965631 GCCAGCGATGGTGGTGTTGGGGG + Intergenic
981034142 4:140152809-140152831 GCGCGCGTTGGGGGTGGTGGTGG - Intronic
985599108 5:816386-816408 GCAGGCGGTGGTGGGGTTGGCGG + Intronic
985915194 5:2912874-2912896 TCATGCCTTGCTGGTGTGGGAGG + Intergenic
997209943 5:132071353-132071375 GCACACTTTGGTGGGGGGGGAGG + Intergenic
998385152 5:141753283-141753305 GCACCCGTTGGGGGTGAGGACGG + Intergenic
1002081349 5:176739511-176739533 GCAGGTGCTGCTGGTGTGGGCGG + Intergenic
1002929678 6:1624566-1624588 GCAGGCGTGGGTCGTGGGGGTGG + Intronic
1003560050 6:7172675-7172697 CCACGGGTTGCCGGTGTGGGGGG + Intronic
1004615101 6:17281637-17281659 GCTGGCGTCGGTGGTGTGGTAGG - Exonic
1006418422 6:33918854-33918876 GCACAGGTTGGGGGGGTGGGCGG + Intergenic
1006538858 6:34722983-34723005 GCAGGGGGTGGTGGTGTTGGGGG - Intergenic
1007480859 6:42148940-42148962 GGACCCCTTGGTGGTGTGGGAGG - Intergenic
1010347541 6:74829600-74829622 GCATGCCTTAGTGGTATGGGTGG - Intergenic
1017980093 6:159393946-159393968 GCACAGGTTGGGGGTGTGGAGGG - Intergenic
1018174645 6:161168116-161168138 GAAGGCGGTGGTGGGGTGGGGGG + Intronic
1018720037 6:166565454-166565476 GCAGGCTTTGCTGGTGTGGCTGG + Intronic
1018807080 6:167270043-167270065 GCACGGGGTGGGGGTGGGGGTGG + Intergenic
1019699665 7:2468528-2468550 GGCCGCGATGGGGGTGTGGGGGG + Intergenic
1019750214 7:2724540-2724562 GCCCTCGTGGGTGGGGTGGGAGG - Intronic
1025024057 7:55501726-55501748 GCACGTGCTGATGGTGAGGGAGG + Intronic
1039610915 8:38918690-38918712 GCATGCGTGTGTGGTGTGTGTGG - Intronic
1040020523 8:42736953-42736975 GCAGGCCTCGGTGGTGGGGGAGG + Exonic
1044712105 8:95067949-95067971 ACACCCTTGGGTGGTGTGGGTGG + Intronic
1047175544 8:122537302-122537324 GCATGAGTTGGGGGTGGGGGTGG - Intergenic
1049558641 8:143296512-143296534 GCACGCGCTGGTGCTGGAGGAGG - Exonic
1055146905 9:72946746-72946768 GCTTGGGATGGTGGTGTGGGGGG - Intronic
1061672930 9:132199146-132199168 GCATGTGTTGGAGGTGTGGAGGG + Intronic
1061869310 9:133511914-133511936 GCACGTGTGTGTGGTGTGTGTGG + Intergenic
1192504155 X:71670706-71670728 GCAGGTGCTGGTGGTGGGGGTGG + Intergenic
1195128262 X:101829963-101829985 ACAAGGGTTGCTGGTGTGGGTGG - Intergenic
1196866786 X:120077798-120077820 GCACGCGTTGGTGGTGTGGGGGG + Intergenic
1196876313 X:120158483-120158505 GCACGCGTTGGTGGTGTGGGGGG - Intergenic
1197147430 X:123185168-123185190 GCAGGCGTTGGTGGTGGATGGGG + Intronic
1198822126 X:140659620-140659642 GCTAGAGTTGGTGGTGGGGGGGG + Intergenic