ID: 1196876314

View in Genome Browser
Species Human (GRCh38)
Location X:120158484-120158506
Sequence AGCACGCGTTGGTGGTGTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 100
Summary {0: 2, 1: 0, 2: 0, 3: 8, 4: 90}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196876314_1196876320 -10 Left 1196876314 X:120158484-120158506 CCCCCACACCACCAACGCGTGCT 0: 2
1: 0
2: 0
3: 8
4: 90
Right 1196876320 X:120158497-120158519 AACGCGTGCTCTCCCTCATCCGG 0: 2
1: 0
2: 0
3: 0
4: 47
1196876314_1196876330 28 Left 1196876314 X:120158484-120158506 CCCCCACACCACCAACGCGTGCT 0: 2
1: 0
2: 0
3: 8
4: 90
Right 1196876330 X:120158535-120158557 TGACGCATGCGCACCTCAGCAGG 0: 2
1: 2
2: 0
3: 3
4: 25
1196876314_1196876321 -9 Left 1196876314 X:120158484-120158506 CCCCCACACCACCAACGCGTGCT 0: 2
1: 0
2: 0
3: 8
4: 90
Right 1196876321 X:120158498-120158520 ACGCGTGCTCTCCCTCATCCGGG 0: 2
1: 0
2: 0
3: 4
4: 84
1196876314_1196876322 -4 Left 1196876314 X:120158484-120158506 CCCCCACACCACCAACGCGTGCT 0: 2
1: 0
2: 0
3: 8
4: 90
Right 1196876322 X:120158503-120158525 TGCTCTCCCTCATCCGGGCAAGG 0: 2
1: 0
2: 0
3: 11
4: 118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196876314 Original CRISPR AGCACGCGTTGGTGGTGTGG GGG (reversed) Intergenic
901685874 1:10943054-10943076 AGCACGAGGTGGGGGTGGGGGGG + Intergenic
904273532 1:29365946-29365968 AGGAAGCGTTGGTGGAGTGATGG - Intergenic
906841262 1:49141986-49142008 AGCACGAGGTGGTGGGGGGGTGG + Intronic
913684068 1:121214938-121214960 AGCAGGAGGTGGTGGGGTGGTGG + Intronic
914035907 1:144002553-144002575 AGCAGGAGGTGGTGGGGTGGTGG + Intergenic
914153549 1:145065392-145065414 AGCAGGAGGTGGTGGGGTGGTGG - Intronic
916121368 1:161531108-161531130 GGTACGCGTTGGTGGTATAGTGG + Intergenic
916131142 1:161612713-161612735 GGGACGCGTTGGTGGTGTAGTGG + Intronic
920471372 1:206233430-206233452 AGCAGGAGGTGGTGGGGTGGTGG + Intronic
1074730302 10:116365421-116365443 AGCACGTGTTGATGGAATGGTGG + Intronic
1077308824 11:1879611-1879633 AGCACCCGCAGGTGGGGTGGAGG + Intronic
1084483921 11:69437269-69437291 AGCACGCCTGGCTGGGGTGGGGG - Intergenic
1084608823 11:70187926-70187948 GGCAGGCTTTGGTGTTGTGGTGG - Exonic
1084957351 11:72698346-72698368 AGAATGCTTTGGTGCTGTGGGGG - Intronic
1086779925 11:90891167-90891189 AGCATGTGTTGGTGGGGTGGCGG - Intergenic
1096642737 12:53006975-53006997 AGCGCGAGTTGGTGGAGGGGCGG + Intronic
1099956014 12:89353366-89353388 AGCAGGCGATGGTGGTGGTGGGG - Intergenic
1099973822 12:89525855-89525877 AGGACGGGTTGGAGGTGGGGGGG - Intronic
1102591311 12:113958743-113958765 AGAAGGGGTTTGTGGTGTGGGGG - Intronic
1121016390 14:90551897-90551919 AACATGCGTGGGTGGGGTGGGGG + Intronic
1121512423 14:94522316-94522338 AGGACGCTTTTGTGGGGTGGTGG - Intergenic
1123699553 15:22904124-22904146 AGCAGGGGTAGGTGGCGTGGAGG - Intronic
1125169495 15:36750084-36750106 GGTTCGCGGTGGTGGTGTGGTGG + Intronic
1130686367 15:86041223-86041245 AGCAGGTGGGGGTGGTGTGGGGG + Intergenic
1131638313 15:94261106-94261128 AGCAGGGGTGGGTGGTGAGGAGG - Intronic
1132770580 16:1560491-1560513 AGGACACGGTGGTGGTGGGGTGG - Intronic
1133688934 16:8194477-8194499 AGCACATGTTGGTTGTGTTGTGG - Intergenic
1138133643 16:54502933-54502955 AACATGAGTTGGTGTTGTGGGGG + Intergenic
1139800838 16:69521427-69521449 AGCATGGGTTTGTGGTGAGGAGG + Intergenic
1141433012 16:83980622-83980644 AACAAGGGTGGGTGGTGTGGGGG + Intronic
1141496667 16:84414965-84414987 GGCAAGCGGCGGTGGTGTGGGGG + Intronic
1141581497 16:85002710-85002732 AGAAAGCGTGGGTGGAGTGGGGG + Intronic
1142507332 17:372931-372953 AACAGGCGGTGGTGGTGGGGAGG + Intronic
1142810360 17:2393137-2393159 AGCCCGCGTTGGGGGGGGGGTGG - Intronic
1147183783 17:38703019-38703041 ACCACGCGTTGGTCGAGTGCGGG - Intergenic
1149503747 17:57175550-57175572 AGAACGAGTTGGTGTGGTGGTGG - Intergenic
1157926362 18:51771148-51771170 AGACAGCATTGGTGGTGTGGGGG + Intergenic
1160349031 18:78159123-78159145 TGCAGTCGTTGGTGGTGGGGCGG - Intergenic
1165274626 19:34737728-34737750 AGCAGGAGGTGGTGGTTTGGGGG + Intronic
1168309149 19:55452002-55452024 GGCCCGGGTTGGTGGGGTGGGGG + Intergenic
925393820 2:3518611-3518633 AGCGCTCGGTGGTGGGGTGGGGG - Intronic
928096181 2:28406584-28406606 GGCACGCCTAGGTGGTGTGGTGG - Intronic
929780845 2:44955858-44955880 AGTGCACGTGGGTGGTGTGGGGG + Intergenic
932215866 2:69965688-69965710 AGCAGGCATGGGTGGTCTGGGGG - Intergenic
932495617 2:72144533-72144555 AGCGCGGGGTGGGGGTGTGGGGG - Intronic
932740512 2:74287334-74287356 AGCACGGAGTGGTAGTGTGGTGG + Intronic
936953425 2:118001095-118001117 AGCACAATTTGGTGGTGTGTAGG + Intronic
937763847 2:125636425-125636447 AGCAAGTGTTGGTGGAGAGGTGG - Intergenic
937766963 2:125672651-125672673 AGCACCCGTTTGTAGTGTGGAGG + Intergenic
938191061 2:129280972-129280994 AGCAAGAGTTGGTGGTGGGGAGG + Intergenic
942568564 2:177290476-177290498 AACACTCATTGGTGGTATGGAGG - Intronic
948735401 2:240000844-240000866 TGCACACCTAGGTGGTGTGGTGG - Intronic
1169018292 20:2309599-2309621 GGCAAGGGATGGTGGTGTGGGGG - Intronic
1169291764 20:4359056-4359078 AGCAGGCGGTGGGGGTGGGGCGG + Intergenic
1176521030 21:7824561-7824583 AGCAGGCATTGGGGGTGTGGAGG - Intronic
1177638893 21:23820884-23820906 TGCACCCCTGGGTGGTGTGGTGG - Intergenic
1178655050 21:34454573-34454595 AGCAGGCATTGGGGGTGTGGAGG - Intergenic
1181000667 22:19986591-19986613 AGCCGGCGTAGGGGGTGTGGAGG + Intronic
1182950649 22:34372549-34372571 AGCTGGCGTTAGGGGTGTGGAGG - Intergenic
953469807 3:43156995-43157017 AGCACGTGTGGGTAGTGTGAGGG + Intergenic
957891749 3:86367922-86367944 GGCACGTGTTGGTGGTAGGGAGG + Intergenic
969271865 4:6108438-6108460 AGCATGCCCTGGGGGTGTGGGGG + Intronic
969914713 4:10478971-10478993 AGCAAGCAGGGGTGGTGTGGTGG - Intergenic
973118100 4:46486465-46486487 AGCATGGGTCGGTGGGGTGGGGG - Intergenic
976780190 4:88749994-88750016 GGCATGCGGTGGTGGGGTGGGGG + Intronic
980299201 4:130965608-130965630 AGCCAGCGATGGTGGTGTTGGGG + Intergenic
982421250 4:155200842-155200864 AGGACCAGTTGGTGGTTTGGGGG + Intergenic
983142239 4:164165458-164165480 AGCACGGCTTGGTTGTGTTGAGG - Intronic
990376805 5:55178306-55178328 AGGAGGTGTTGGTGGTGTTGTGG - Intergenic
996087494 5:119320016-119320038 ACCATGGGTTGGTGGTGGGGTGG + Intronic
996308792 5:122079529-122079551 ACCACATTTTGGTGGTGTGGTGG + Intergenic
998280011 5:140796891-140796913 AGCACGAGTAGGCGGTGTCGAGG - Exonic
998620341 5:143787759-143787781 AGTACTCGTGGGTGGTGTTGAGG + Intergenic
1002636864 5:180612953-180612975 AGCAAGCGTCGGGGGCGTGGGGG - Intronic
1003079022 6:3006089-3006111 CGCACCCATTGGTGGTGTGGCGG + Intronic
1003414463 6:5895599-5895621 ATCATGGGTTGGTGGTGGGGAGG - Intergenic
1003598571 6:7496874-7496896 AGAACTCATTGGTGGTGTAGTGG + Intergenic
1017980094 6:159393947-159393969 GGCACAGGTTGGGGGTGTGGAGG - Intergenic
1018207117 6:161446099-161446121 AGCATGGGGTGGTGGTGGGGTGG + Intronic
1026794959 7:73360030-73360052 AACCCGCGTTGCTGGAGTGGTGG + Intergenic
1030320976 7:108166966-108166988 AGTTCGAGTTGGTGCTGTGGGGG - Exonic
1033506050 7:142001549-142001571 AGCAAGCATTGGTGGGTTGGTGG + Intronic
1036516673 8:9450711-9450733 AGCCCGGGTTGGGGGTGGGGAGG + Intergenic
1040434822 8:47380188-47380210 AGCACGCGTTGCTGTGGTGCAGG - Intronic
1041289004 8:56290691-56290713 TGCACGCGTCAGTGGTGAGGAGG + Intergenic
1043754361 8:83984500-83984522 ATCTCGTGGTGGTGGTGTGGTGG - Intergenic
1049212573 8:141393459-141393481 AGAACACGTTGGGGGTGTTGAGG - Intronic
1055654969 9:78442349-78442371 AGCCCACGTTGGGGGTGGGGAGG - Intergenic
1057280299 9:93706216-93706238 AGCACGTCTTGGTGTTGAGGTGG - Intergenic
1058725996 9:107804717-107804739 AGCAAGTGTGGATGGTGTGGTGG + Intergenic
1061672929 9:132199145-132199167 TGCATGTGTTGGAGGTGTGGAGG + Intronic
1062022273 9:134325343-134325365 AGCTCGCGGTGGGGGTGCGGAGG + Intronic
1185499673 X:587287-587309 AGCACGCGTTGGAGGCTTAGGGG - Intergenic
1187195586 X:17080428-17080450 AGAACAAGGTGGTGGTGTGGGGG - Intronic
1187485922 X:19703275-19703297 AGAAAGAGTTGGTGGTGAGGAGG + Intronic
1190682540 X:52840294-52840316 ATCACACCTTGGTGGGGTGGTGG + Intergenic
1196866785 X:120077797-120077819 AGCACGCGTTGGTGGTGTGGGGG + Intergenic
1196876314 X:120158484-120158506 AGCACGCGTTGGTGGTGTGGGGG - Intergenic
1197147429 X:123185167-123185189 AGCAGGCGTTGGTGGTGGATGGG + Intronic
1201964178 Y:19713646-19713668 AGCAGGTGTTGGTGAGGTGGCGG + Intronic