ID: 1196876320

View in Genome Browser
Species Human (GRCh38)
Location X:120158497-120158519
Sequence AACGCGTGCTCTCCCTCATC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 49
Summary {0: 2, 1: 0, 2: 0, 3: 0, 4: 47}

Found 19 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196876299_1196876320 27 Left 1196876299 X:120158447-120158469 CCCTCCCCCACACCCTACTACAC 0: 2
1: 1
2: 1
3: 66
4: 892
Right 1196876320 X:120158497-120158519 AACGCGTGCTCTCCCTCATCCGG 0: 2
1: 0
2: 0
3: 0
4: 47
1196876303_1196876320 21 Left 1196876303 X:120158453-120158475 CCCACACCCTACTACACCACTTA 0: 2
1: 0
2: 0
3: 6
4: 106
Right 1196876320 X:120158497-120158519 AACGCGTGCTCTCCCTCATCCGG 0: 2
1: 0
2: 0
3: 0
4: 47
1196876296_1196876320 30 Left 1196876296 X:120158444-120158466 CCCCCCTCCCCCACACCCTACTA 0: 2
1: 0
2: 12
3: 176
4: 1352
Right 1196876320 X:120158497-120158519 AACGCGTGCTCTCCCTCATCCGG 0: 2
1: 0
2: 0
3: 0
4: 47
1196876302_1196876320 22 Left 1196876302 X:120158452-120158474 CCCCACACCCTACTACACCACTT 0: 2
1: 0
2: 1
3: 7
4: 183
Right 1196876320 X:120158497-120158519 AACGCGTGCTCTCCCTCATCCGG 0: 2
1: 0
2: 0
3: 0
4: 47
1196876308_1196876320 -2 Left 1196876308 X:120158476-120158498 CCCCTCCCCCCCCACACCACCAA 0: 2
1: 1
2: 13
3: 273
4: 3647
Right 1196876320 X:120158497-120158519 AACGCGTGCTCTCCCTCATCCGG 0: 2
1: 0
2: 0
3: 0
4: 47
1196876311_1196876320 -7 Left 1196876311 X:120158481-120158503 CCCCCCCCACACCACCAACGCGT 0: 2
1: 0
2: 0
3: 13
4: 236
Right 1196876320 X:120158497-120158519 AACGCGTGCTCTCCCTCATCCGG 0: 2
1: 0
2: 0
3: 0
4: 47
1196876301_1196876320 23 Left 1196876301 X:120158451-120158473 CCCCCACACCCTACTACACCACT 0: 2
1: 0
2: 2
3: 27
4: 326
Right 1196876320 X:120158497-120158519 AACGCGTGCTCTCCCTCATCCGG 0: 2
1: 0
2: 0
3: 0
4: 47
1196876309_1196876320 -3 Left 1196876309 X:120158477-120158499 CCCTCCCCCCCCACACCACCAAC 0: 2
1: 0
2: 10
3: 221
4: 1988
Right 1196876320 X:120158497-120158519 AACGCGTGCTCTCCCTCATCCGG 0: 2
1: 0
2: 0
3: 0
4: 47
1196876304_1196876320 20 Left 1196876304 X:120158454-120158476 CCACACCCTACTACACCACTTAC 0: 2
1: 0
2: 1
3: 12
4: 181
Right 1196876320 X:120158497-120158519 AACGCGTGCTCTCCCTCATCCGG 0: 2
1: 0
2: 0
3: 0
4: 47
1196876307_1196876320 5 Left 1196876307 X:120158469-120158491 CCACTTACCCCTCCCCCCCCACA 0: 2
1: 0
2: 9
3: 195
4: 2086
Right 1196876320 X:120158497-120158519 AACGCGTGCTCTCCCTCATCCGG 0: 2
1: 0
2: 0
3: 0
4: 47
1196876310_1196876320 -4 Left 1196876310 X:120158478-120158500 CCTCCCCCCCCACACCACCAACG 0: 2
1: 0
2: 4
3: 145
4: 2726
Right 1196876320 X:120158497-120158519 AACGCGTGCTCTCCCTCATCCGG 0: 2
1: 0
2: 0
3: 0
4: 47
1196876314_1196876320 -10 Left 1196876314 X:120158484-120158506 CCCCCACACCACCAACGCGTGCT 0: 2
1: 0
2: 0
3: 8
4: 90
Right 1196876320 X:120158497-120158519 AACGCGTGCTCTCCCTCATCCGG 0: 2
1: 0
2: 0
3: 0
4: 47
1196876306_1196876320 14 Left 1196876306 X:120158460-120158482 CCTACTACACCACTTACCCCTCC 0: 2
1: 0
2: 0
3: 15
4: 232
Right 1196876320 X:120158497-120158519 AACGCGTGCTCTCCCTCATCCGG 0: 2
1: 0
2: 0
3: 0
4: 47
1196876297_1196876320 29 Left 1196876297 X:120158445-120158467 CCCCCTCCCCCACACCCTACTAC 0: 2
1: 0
2: 12
3: 260
4: 1974
Right 1196876320 X:120158497-120158519 AACGCGTGCTCTCCCTCATCCGG 0: 2
1: 0
2: 0
3: 0
4: 47
1196876313_1196876320 -9 Left 1196876313 X:120158483-120158505 CCCCCCACACCACCAACGCGTGC 0: 2
1: 0
2: 2
3: 8
4: 138
Right 1196876320 X:120158497-120158519 AACGCGTGCTCTCCCTCATCCGG 0: 2
1: 0
2: 0
3: 0
4: 47
1196876312_1196876320 -8 Left 1196876312 X:120158482-120158504 CCCCCCCACACCACCAACGCGTG 0: 2
1: 0
2: 1
3: 15
4: 176
Right 1196876320 X:120158497-120158519 AACGCGTGCTCTCCCTCATCCGG 0: 2
1: 0
2: 0
3: 0
4: 47
1196876300_1196876320 26 Left 1196876300 X:120158448-120158470 CCTCCCCCACACCCTACTACACC 0: 2
1: 0
2: 5
3: 52
4: 680
Right 1196876320 X:120158497-120158519 AACGCGTGCTCTCCCTCATCCGG 0: 2
1: 0
2: 0
3: 0
4: 47
1196876298_1196876320 28 Left 1196876298 X:120158446-120158468 CCCCTCCCCCACACCCTACTACA 0: 2
1: 0
2: 8
3: 206
4: 1645
Right 1196876320 X:120158497-120158519 AACGCGTGCTCTCCCTCATCCGG 0: 2
1: 0
2: 0
3: 0
4: 47
1196876305_1196876320 15 Left 1196876305 X:120158459-120158481 CCCTACTACACCACTTACCCCTC 0: 2
1: 0
2: 1
3: 15
4: 106
Right 1196876320 X:120158497-120158519 AACGCGTGCTCTCCCTCATCCGG 0: 2
1: 0
2: 0
3: 0
4: 47

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196876320 Original CRISPR AACGCGTGCTCTCCCTCATC CGG Intergenic