ID: 1196877993

View in Genome Browser
Species Human (GRCh38)
Location X:120172174-120172196
Sequence TCTAGGGAACCCTAATGCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1196877993_1196877999 27 Left 1196877993 X:120172174-120172196 CCAGTGCATTAGGGTTCCCTAGA No data
Right 1196877999 X:120172224-120172246 AGATATATAGATATATATGTAGG No data
1196877993_1196877998 -6 Left 1196877993 X:120172174-120172196 CCAGTGCATTAGGGTTCCCTAGA No data
Right 1196877998 X:120172191-120172213 CCTAGAGGGACAGAACAAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1196877993 Original CRISPR TCTAGGGAACCCTAATGCAC TGG (reversed) Intergenic
No off target data available for this crispr